ID: 1134368283

View in Genome Browser
Species Human (GRCh38)
Location 16:13599549-13599571
Sequence CAACATATGACAGATTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134368283_1134368284 -4 Left 1134368283 16:13599549-13599571 CCTTCTTAATCTGTCATATGTTG No data
Right 1134368284 16:13599568-13599590 GTTGTTATGTGACAATAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134368283 Original CRISPR CAACATATGACAGATTAAGA AGG (reversed) Intergenic
No off target data available for this crispr