ID: 1134369042

View in Genome Browser
Species Human (GRCh38)
Location 16:13606545-13606567
Sequence TGTAATTCCTCCCTTAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134369042_1134369049 30 Left 1134369042 16:13606545-13606567 CCCACGCTAAGGGAGGAATTACA No data
Right 1134369049 16:13606598-13606620 CCTAGGATCCGCCGACGTGGTGG No data
1134369042_1134369047 27 Left 1134369042 16:13606545-13606567 CCCACGCTAAGGGAGGAATTACA No data
Right 1134369047 16:13606595-13606617 AGTCCTAGGATCCGCCGACGTGG No data
1134369042_1134369046 13 Left 1134369042 16:13606545-13606567 CCCACGCTAAGGGAGGAATTACA No data
Right 1134369046 16:13606581-13606603 CTTATAAAAAAAAAAGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134369042 Original CRISPR TGTAATTCCTCCCTTAGCGT GGG (reversed) Intergenic
No off target data available for this crispr