ID: 1134375975

View in Genome Browser
Species Human (GRCh38)
Location 16:13673619-13673641
Sequence CATCAGAGTGAGACCCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134375969_1134375975 -3 Left 1134375969 16:13673599-13673621 CCACTGCACCCCCGCCTGCACAT No data
Right 1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134375975 Original CRISPR CATCAGAGTGAGACCCTGTC AGG Intergenic
No off target data available for this crispr