ID: 1134377864

View in Genome Browser
Species Human (GRCh38)
Location 16:13695169-13695191
Sequence CAGACTAAGGAAAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134377858_1134377864 23 Left 1134377858 16:13695123-13695145 CCAACTGACAGATATTTTATGTT No data
Right 1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134377864 Original CRISPR CAGACTAAGGAAAAAGAGGA GGG Intergenic
No off target data available for this crispr