ID: 1134378782

View in Genome Browser
Species Human (GRCh38)
Location 16:13704475-13704497
Sequence CGCAGGTGTCAGACAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134378774_1134378782 16 Left 1134378774 16:13704436-13704458 CCAAAGACTTTGAAAACTGACAG No data
Right 1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG No data
1134378773_1134378782 29 Left 1134378773 16:13704423-13704445 CCTAAACAACATACCAAAGACTT No data
Right 1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG No data
1134378772_1134378782 30 Left 1134378772 16:13704422-13704444 CCCTAAACAACATACCAAAGACT No data
Right 1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134378782 Original CRISPR CGCAGGTGTCAGACAGGCCA AGG Intergenic
No off target data available for this crispr