ID: 1134380692

View in Genome Browser
Species Human (GRCh38)
Location 16:13722087-13722109
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134380692 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr