ID: 1134381251

View in Genome Browser
Species Human (GRCh38)
Location 16:13728534-13728556
Sequence TCTTCCAAGCATACATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134381251_1134381258 22 Left 1134381251 16:13728534-13728556 CCTCCCAATGTATGCTTGGAAGA No data
Right 1134381258 16:13728579-13728601 CCAATACAGCACGTTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134381251 Original CRISPR TCTTCCAAGCATACATTGGG AGG (reversed) Intergenic
No off target data available for this crispr