ID: 1134382134

View in Genome Browser
Species Human (GRCh38)
Location 16:13737695-13737717
Sequence TGTTAGCAAGAGCAGTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134382134_1134382137 3 Left 1134382134 16:13737695-13737717 CCATGAAACTGCTCTTGCTAACA No data
Right 1134382137 16:13737721-13737743 CCAGTGACTCCACAATGCCAGGG No data
1134382134_1134382135 2 Left 1134382134 16:13737695-13737717 CCATGAAACTGCTCTTGCTAACA No data
Right 1134382135 16:13737720-13737742 TCCAGTGACTCCACAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134382134 Original CRISPR TGTTAGCAAGAGCAGTTTCA TGG (reversed) Intergenic
No off target data available for this crispr