ID: 1134384214

View in Genome Browser
Species Human (GRCh38)
Location 16:13756906-13756928
Sequence AAGGGTAAACTTGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134384214_1134384222 16 Left 1134384214 16:13756906-13756928 CCTCCCTCCTCAAGTTTACCCTT No data
Right 1134384222 16:13756945-13756967 CTAATACGTGTCATAGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134384214 Original CRISPR AAGGGTAAACTTGAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr