ID: 1134385914

View in Genome Browser
Species Human (GRCh38)
Location 16:13772268-13772290
Sequence TCCCACAACAAAATCACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134385911_1134385914 11 Left 1134385911 16:13772234-13772256 CCATCTAGGTTTGTGTAAGTGCA 0: 92
1: 651
2: 1177
3: 1274
4: 1102
Right 1134385914 16:13772268-13772290 TCCCACAACAAAATCACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134385914 Original CRISPR TCCCACAACAAAATCACCTA GGG Intergenic
No off target data available for this crispr