ID: 1134387534

View in Genome Browser
Species Human (GRCh38)
Location 16:13787856-13787878
Sequence CTCGTGCCTGCAGCCTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134387534_1134387537 23 Left 1134387534 16:13787856-13787878 CCTCCATAGGCTGCAGGCACGAG No data
Right 1134387537 16:13787902-13787924 GACCTTTCAAAACAGATCTCTGG No data
1134387534_1134387538 24 Left 1134387534 16:13787856-13787878 CCTCCATAGGCTGCAGGCACGAG No data
Right 1134387538 16:13787903-13787925 ACCTTTCAAAACAGATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134387534 Original CRISPR CTCGTGCCTGCAGCCTATGG AGG (reversed) Intergenic
No off target data available for this crispr