ID: 1134387536

View in Genome Browser
Species Human (GRCh38)
Location 16:13787859-13787881
Sequence TGCCTCGTGCCTGCAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134387536_1134387538 21 Left 1134387536 16:13787859-13787881 CCATAGGCTGCAGGCACGAGGCA No data
Right 1134387538 16:13787903-13787925 ACCTTTCAAAACAGATCTCTGGG No data
1134387536_1134387537 20 Left 1134387536 16:13787859-13787881 CCATAGGCTGCAGGCACGAGGCA No data
Right 1134387537 16:13787902-13787924 GACCTTTCAAAACAGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134387536 Original CRISPR TGCCTCGTGCCTGCAGCCTA TGG (reversed) Intergenic