ID: 1134387538

View in Genome Browser
Species Human (GRCh38)
Location 16:13787903-13787925
Sequence ACCTTTCAAAACAGATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134387534_1134387538 24 Left 1134387534 16:13787856-13787878 CCTCCATAGGCTGCAGGCACGAG No data
Right 1134387538 16:13787903-13787925 ACCTTTCAAAACAGATCTCTGGG No data
1134387536_1134387538 21 Left 1134387536 16:13787859-13787881 CCATAGGCTGCAGGCACGAGGCA No data
Right 1134387538 16:13787903-13787925 ACCTTTCAAAACAGATCTCTGGG No data
1134387532_1134387538 26 Left 1134387532 16:13787854-13787876 CCCCTCCATAGGCTGCAGGCACG No data
Right 1134387538 16:13787903-13787925 ACCTTTCAAAACAGATCTCTGGG No data
1134387533_1134387538 25 Left 1134387533 16:13787855-13787877 CCCTCCATAGGCTGCAGGCACGA No data
Right 1134387538 16:13787903-13787925 ACCTTTCAAAACAGATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134387538 Original CRISPR ACCTTTCAAAACAGATCTCT GGG Intergenic
No off target data available for this crispr