ID: 1134388394

View in Genome Browser
Species Human (GRCh38)
Location 16:13795425-13795447
Sequence CATAAGGAATGATGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134388385_1134388394 28 Left 1134388385 16:13795374-13795396 CCCATTTGCCTAGTGGCTAAATG No data
Right 1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG No data
1134388386_1134388394 27 Left 1134388386 16:13795375-13795397 CCATTTGCCTAGTGGCTAAATGA No data
Right 1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG No data
1134388384_1134388394 29 Left 1134388384 16:13795373-13795395 CCCCATTTGCCTAGTGGCTAAAT No data
Right 1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG No data
1134388387_1134388394 20 Left 1134388387 16:13795382-13795404 CCTAGTGGCTAAATGATTCACTT No data
Right 1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG No data
1134388389_1134388394 -8 Left 1134388389 16:13795410-13795432 CCATTGACTTGTACCCATAAGGA No data
Right 1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134388394 Original CRISPR CATAAGGAATGATGGGAAAT TGG Intergenic
No off target data available for this crispr