ID: 1134388892

View in Genome Browser
Species Human (GRCh38)
Location 16:13800349-13800371
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134388889_1134388892 27 Left 1134388889 16:13800299-13800321 CCTCAGACATGAAAAAACATATA No data
Right 1134388892 16:13800349-13800371 CCCCTGAGCCCCCACCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134388892 Original CRISPR CCCCTGAGCCCCCACCTACT AGG Intergenic