ID: 1134394194

View in Genome Browser
Species Human (GRCh38)
Location 16:13848095-13848117
Sequence AGCCAAAATGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134394192_1134394194 0 Left 1134394192 16:13848072-13848094 CCCTCTCTCTGAGGAGTTATGAC No data
Right 1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG No data
1134394193_1134394194 -1 Left 1134394193 16:13848073-13848095 CCTCTCTCTGAGGAGTTATGACA No data
Right 1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134394194 Original CRISPR AGCCAAAATGTCTCCAGACA TGG Intergenic
No off target data available for this crispr