ID: 1134395010

View in Genome Browser
Species Human (GRCh38)
Location 16:13854603-13854625
Sequence CCTAGGGGACTGTATTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134395010_1134395013 -10 Left 1134395010 16:13854603-13854625 CCATTGTAATACAGTCCCCTAGG No data
Right 1134395013 16:13854616-13854638 GTCCCCTAGGTGTTCCCCCTGGG No data
1134395010_1134395017 0 Left 1134395010 16:13854603-13854625 CCATTGTAATACAGTCCCCTAGG No data
Right 1134395017 16:13854626-13854648 TGTTCCCCCTGGGTGCTTGCAGG No data
1134395010_1134395022 17 Left 1134395010 16:13854603-13854625 CCATTGTAATACAGTCCCCTAGG No data
Right 1134395022 16:13854643-13854665 TGCAGGCCCCTTCAGTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134395010 Original CRISPR CCTAGGGGACTGTATTACAA TGG (reversed) Intergenic
No off target data available for this crispr