ID: 1134395313

View in Genome Browser
Species Human (GRCh38)
Location 16:13857088-13857110
Sequence ATAGTTAACCAGTTCCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134395313_1134395314 0 Left 1134395313 16:13857088-13857110 CCAATAGGGAACTGGTTAACTAT No data
Right 1134395314 16:13857111-13857133 TCCATGTTCTAACCACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134395313 Original CRISPR ATAGTTAACCAGTTCCCTAT TGG (reversed) Intergenic
No off target data available for this crispr