ID: 1134395351

View in Genome Browser
Species Human (GRCh38)
Location 16:13857681-13857703
Sequence TTCCCATCACAAAGGCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134395351_1134395358 20 Left 1134395351 16:13857681-13857703 CCCCTTAGCCTTTGTGATGGGAA No data
Right 1134395358 16:13857724-13857746 CGCCTGACTATAAATGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134395351 Original CRISPR TTCCCATCACAAAGGCTAAG GGG (reversed) Intergenic
No off target data available for this crispr