ID: 1134395377

View in Genome Browser
Species Human (GRCh38)
Location 16:13857851-13857873
Sequence GCATCTAGAAAGTGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134395377_1134395380 -1 Left 1134395377 16:13857851-13857873 CCAGTTTTCCACTTTCTAGATGC No data
Right 1134395380 16:13857873-13857895 CCTCTTTACCCGCCCACAGCAGG No data
1134395377_1134395381 0 Left 1134395377 16:13857851-13857873 CCAGTTTTCCACTTTCTAGATGC No data
Right 1134395381 16:13857874-13857896 CTCTTTACCCGCCCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134395377 Original CRISPR GCATCTAGAAAGTGGAAAAC TGG (reversed) Intergenic
No off target data available for this crispr