ID: 1134396389

View in Genome Browser
Species Human (GRCh38)
Location 16:13868249-13868271
Sequence GTTTCTCAGGGGTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134396389_1134396396 9 Left 1134396389 16:13868249-13868271 CCTTCCTCAAACCCCTGAGAAAC No data
Right 1134396396 16:13868281-13868303 CTTTCTATATTGTATTCACGAGG No data
1134396389_1134396399 24 Left 1134396389 16:13868249-13868271 CCTTCCTCAAACCCCTGAGAAAC No data
Right 1134396399 16:13868296-13868318 TCACGAGGAGGCAACACTGTGGG No data
1134396389_1134396397 12 Left 1134396389 16:13868249-13868271 CCTTCCTCAAACCCCTGAGAAAC No data
Right 1134396397 16:13868284-13868306 TCTATATTGTATTCACGAGGAGG No data
1134396389_1134396401 30 Left 1134396389 16:13868249-13868271 CCTTCCTCAAACCCCTGAGAAAC No data
Right 1134396401 16:13868302-13868324 GGAGGCAACACTGTGGGACTGGG No data
1134396389_1134396398 23 Left 1134396389 16:13868249-13868271 CCTTCCTCAAACCCCTGAGAAAC No data
Right 1134396398 16:13868295-13868317 TTCACGAGGAGGCAACACTGTGG No data
1134396389_1134396400 29 Left 1134396389 16:13868249-13868271 CCTTCCTCAAACCCCTGAGAAAC No data
Right 1134396400 16:13868301-13868323 AGGAGGCAACACTGTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134396389 Original CRISPR GTTTCTCAGGGGTTTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr