ID: 1134401100

View in Genome Browser
Species Human (GRCh38)
Location 16:13910488-13910510
Sequence TTAGGTTTCTAAATGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401100_1134401106 -1 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401106 16:13910510-13910532 AAAACACCATCTGGGCTTGGTGG No data
1134401100_1134401103 -9 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401103 16:13910502-13910524 GAAACCTAAAAACACCATCTGGG No data
1134401100_1134401102 -10 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401102 16:13910501-13910523 AGAAACCTAAAAACACCATCTGG No data
1134401100_1134401108 26 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401108 16:13910537-13910559 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767
1134401100_1134401109 27 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401109 16:13910538-13910560 GCCTGTGATCCCAGCACTTTGGG 0: 2206
1: 222624
2: 272239
3: 185198
4: 147020
1134401100_1134401111 30 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401111 16:13910541-13910563 TGTGATCCCAGCACTTTGGGAGG 0: 3016
1: 296324
2: 266060
3: 153853
4: 140975
1134401100_1134401105 -4 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401105 16:13910507-13910529 CTAAAAACACCATCTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401100 Original CRISPR TTAGGTTTCTAAATGTATGG AGG (reversed) Intergenic
No off target data available for this crispr