ID: 1134401104

View in Genome Browser
Species Human (GRCh38)
Location 16:13910506-13910528
Sequence CAAGCCCAGATGGTGTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401104_1134401117 25 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401117 16:13910554-13910576 CTTTGGGAGGCTGAGGCGGGTGG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
1134401104_1134401115 21 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401115 16:13910550-13910572 AGCACTTTGGGAGGCTGAGGCGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
1134401104_1134401109 9 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401109 16:13910538-13910560 GCCTGTGATCCCAGCACTTTGGG 0: 2206
1: 222624
2: 272239
3: 185198
4: 147020
1134401104_1134401108 8 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401108 16:13910537-13910559 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767
1134401104_1134401116 22 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401116 16:13910551-13910573 GCACTTTGGGAGGCTGAGGCGGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1134401104_1134401113 18 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401113 16:13910547-13910569 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
1134401104_1134401111 12 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401111 16:13910541-13910563 TGTGATCCCAGCACTTTGGGAGG 0: 3016
1: 296324
2: 266060
3: 153853
4: 140975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401104 Original CRISPR CAAGCCCAGATGGTGTTTTT AGG (reversed) Intergenic
No off target data available for this crispr