ID: 1134401108

View in Genome Browser
Species Human (GRCh38)
Location 16:13910537-13910559
Sequence TGCCTGTGATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 788000
Summary {0: 1055, 1: 93536, 2: 232660, 3: 241982, 4: 218767}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401100_1134401108 26 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401108 16:13910537-13910559 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767
1134401104_1134401108 8 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401108 16:13910537-13910559 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767
1134401101_1134401108 23 Left 1134401101 16:13910491-13910513 CCATACATTTAGAAACCTAAAAA No data
Right 1134401108 16:13910537-13910559 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767
1134401107_1134401108 -2 Left 1134401107 16:13910516-13910538 CCATCTGGGCTTGGTGGCTCATG No data
Right 1134401108 16:13910537-13910559 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401108 Original CRISPR TGCCTGTGATCCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr