ID: 1134401111

View in Genome Browser
Species Human (GRCh38)
Location 16:13910541-13910563
Sequence TGTGATCCCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 860228
Summary {0: 3016, 1: 296324, 2: 266060, 3: 153853, 4: 140975}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401100_1134401111 30 Left 1134401100 16:13910488-13910510 CCTCCATACATTTAGAAACCTAA No data
Right 1134401111 16:13910541-13910563 TGTGATCCCAGCACTTTGGGAGG 0: 3016
1: 296324
2: 266060
3: 153853
4: 140975
1134401104_1134401111 12 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401111 16:13910541-13910563 TGTGATCCCAGCACTTTGGGAGG 0: 3016
1: 296324
2: 266060
3: 153853
4: 140975
1134401101_1134401111 27 Left 1134401101 16:13910491-13910513 CCATACATTTAGAAACCTAAAAA No data
Right 1134401111 16:13910541-13910563 TGTGATCCCAGCACTTTGGGAGG 0: 3016
1: 296324
2: 266060
3: 153853
4: 140975
1134401107_1134401111 2 Left 1134401107 16:13910516-13910538 CCATCTGGGCTTGGTGGCTCATG No data
Right 1134401111 16:13910541-13910563 TGTGATCCCAGCACTTTGGGAGG 0: 3016
1: 296324
2: 266060
3: 153853
4: 140975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401111 Original CRISPR TGTGATCCCAGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr