ID: 1134401113

View in Genome Browser
Species Human (GRCh38)
Location 16:13910547-13910569
Sequence CCCAGCACTTTGGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1083691
Summary {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401104_1134401113 18 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401113 16:13910547-13910569 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
1134401107_1134401113 8 Left 1134401107 16:13910516-13910538 CCATCTGGGCTTGGTGGCTCATG No data
Right 1134401113 16:13910547-13910569 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401113 Original CRISPR CCCAGCACTTTGGGAGGCTG AGG Intergenic
Too many off-targets to display for this crispr