ID: 1134401115

View in Genome Browser
Species Human (GRCh38)
Location 16:13910550-13910572
Sequence AGCACTTTGGGAGGCTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557090
Summary {0: 60215, 1: 147830, 2: 155736, 3: 113395, 4: 79914}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401107_1134401115 11 Left 1134401107 16:13910516-13910538 CCATCTGGGCTTGGTGGCTCATG No data
Right 1134401115 16:13910550-13910572 AGCACTTTGGGAGGCTGAGGCGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
1134401104_1134401115 21 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401115 16:13910550-13910572 AGCACTTTGGGAGGCTGAGGCGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401115 Original CRISPR AGCACTTTGGGAGGCTGAGG CGG Intergenic
Too many off-targets to display for this crispr