ID: 1134401116

View in Genome Browser
Species Human (GRCh38)
Location 16:13910551-13910573
Sequence GCACTTTGGGAGGCTGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1032626
Summary {0: 59629, 1: 175979, 2: 229415, 3: 270535, 4: 297068}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401107_1134401116 12 Left 1134401107 16:13910516-13910538 CCATCTGGGCTTGGTGGCTCATG No data
Right 1134401116 16:13910551-13910573 GCACTTTGGGAGGCTGAGGCGGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1134401104_1134401116 22 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401116 16:13910551-13910573 GCACTTTGGGAGGCTGAGGCGGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401116 Original CRISPR GCACTTTGGGAGGCTGAGGC GGG Intergenic
Too many off-targets to display for this crispr