ID: 1134401117

View in Genome Browser
Species Human (GRCh38)
Location 16:13910554-13910576
Sequence CTTTGGGAGGCTGAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 608038
Summary {0: 20304, 1: 108143, 2: 164903, 3: 177131, 4: 137557}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134401104_1134401117 25 Left 1134401104 16:13910506-13910528 CCTAAAAACACCATCTGGGCTTG No data
Right 1134401117 16:13910554-13910576 CTTTGGGAGGCTGAGGCGGGTGG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
1134401110_1134401117 -8 Left 1134401110 16:13910539-13910561 CCTGTGATCCCAGCACTTTGGGA 0: 2928
1: 292542
2: 261985
3: 151313
4: 136324
Right 1134401117 16:13910554-13910576 CTTTGGGAGGCTGAGGCGGGTGG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
1134401107_1134401117 15 Left 1134401107 16:13910516-13910538 CCATCTGGGCTTGGTGGCTCATG No data
Right 1134401117 16:13910554-13910576 CTTTGGGAGGCTGAGGCGGGTGG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134401117 Original CRISPR CTTTGGGAGGCTGAGGCGGG TGG Intergenic
Too many off-targets to display for this crispr