ID: 1134406242

View in Genome Browser
Species Human (GRCh38)
Location 16:13961439-13961461
Sequence GATCCGAACAGCTGAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134406242_1134406245 -6 Left 1134406242 16:13961439-13961461 CCATGTCCTCAGCTGTTCGGATC No data
Right 1134406245 16:13961456-13961478 CGGATCTTCAGGCTGTTCGCCGG No data
1134406242_1134406250 17 Left 1134406242 16:13961439-13961461 CCATGTCCTCAGCTGTTCGGATC No data
Right 1134406250 16:13961479-13961501 TTTCGAGGAGTGGTGTCAGAGGG No data
1134406242_1134406246 2 Left 1134406242 16:13961439-13961461 CCATGTCCTCAGCTGTTCGGATC No data
Right 1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG No data
1134406242_1134406249 16 Left 1134406242 16:13961439-13961461 CCATGTCCTCAGCTGTTCGGATC No data
Right 1134406249 16:13961478-13961500 GTTTCGAGGAGTGGTGTCAGAGG No data
1134406242_1134406247 7 Left 1134406242 16:13961439-13961461 CCATGTCCTCAGCTGTTCGGATC No data
Right 1134406247 16:13961469-13961491 TGTTCGCCGGTTTCGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134406242 Original CRISPR GATCCGAACAGCTGAGGACA TGG (reversed) Intergenic
No off target data available for this crispr