ID: 1134406243

View in Genome Browser
Species Human (GRCh38)
Location 16:13961445-13961467
Sequence CCTGAAGATCCGAACAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134406243_1134406251 25 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406251 16:13961493-13961515 GTCAGAGGGCAGTTTTGAAATGG No data
1134406243_1134406250 11 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406250 16:13961479-13961501 TTTCGAGGAGTGGTGTCAGAGGG No data
1134406243_1134406246 -4 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG No data
1134406243_1134406252 26 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406252 16:13961494-13961516 TCAGAGGGCAGTTTTGAAATGGG No data
1134406243_1134406247 1 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406247 16:13961469-13961491 TGTTCGCCGGTTTCGAGGAGTGG No data
1134406243_1134406249 10 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406249 16:13961478-13961500 GTTTCGAGGAGTGGTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134406243 Original CRISPR CCTGAAGATCCGAACAGCTG AGG (reversed) Intergenic
No off target data available for this crispr