ID: 1134406246

View in Genome Browser
Species Human (GRCh38)
Location 16:13961464-13961486
Sequence CAGGCTGTTCGCCGGTTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134406241_1134406246 3 Left 1134406241 16:13961438-13961460 CCCATGTCCTCAGCTGTTCGGAT No data
Right 1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG No data
1134406242_1134406246 2 Left 1134406242 16:13961439-13961461 CCATGTCCTCAGCTGTTCGGATC No data
Right 1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG No data
1134406243_1134406246 -4 Left 1134406243 16:13961445-13961467 CCTCAGCTGTTCGGATCTTCAGG No data
Right 1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134406246 Original CRISPR CAGGCTGTTCGCCGGTTTCG AGG Intergenic
No off target data available for this crispr