ID: 1134407164

View in Genome Browser
Species Human (GRCh38)
Location 16:13970585-13970607
Sequence TGGGACAGCACAGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407164_1134407174 26 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407174 16:13970634-13970656 ACACAGCCACTGCTGGGGGAAGG No data
1134407164_1134407169 19 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407169 16:13970627-13970649 CTGTGCCACACAGCCACTGCTGG No data
1134407164_1134407170 20 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407170 16:13970628-13970650 TGTGCCACACAGCCACTGCTGGG No data
1134407164_1134407171 21 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407171 16:13970629-13970651 GTGCCACACAGCCACTGCTGGGG No data
1134407164_1134407175 29 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407175 16:13970637-13970659 CAGCCACTGCTGGGGGAAGGAGG No data
1134407164_1134407172 22 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407164 Original CRISPR TGGGACAGCACAGTGATTGC AGG (reversed) Intergenic
No off target data available for this crispr