ID: 1134407168

View in Genome Browser
Species Human (GRCh38)
Location 16:13970611-13970633
Sequence GGCACAGAGAATCTGTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407168_1134407172 -4 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345
1134407168_1134407180 17 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407180 16:13970651-13970673 GGAAGGAGGAAGGGTGGCATTGG No data
1134407168_1134407171 -5 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407171 16:13970629-13970651 GTGCCACACAGCCACTGCTGGGG No data
1134407168_1134407170 -6 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407170 16:13970628-13970650 TGTGCCACACAGCCACTGCTGGG No data
1134407168_1134407169 -7 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407169 16:13970627-13970649 CTGTGCCACACAGCCACTGCTGG No data
1134407168_1134407179 11 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data
1134407168_1134407177 7 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG No data
1134407168_1134407178 8 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407178 16:13970642-13970664 ACTGCTGGGGGAAGGAGGAAGGG No data
1134407168_1134407174 0 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407174 16:13970634-13970656 ACACAGCCACTGCTGGGGGAAGG No data
1134407168_1134407175 3 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407175 16:13970637-13970659 CAGCCACTGCTGGGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407168 Original CRISPR GGCACAGAGAATCTGTGCAC TGG (reversed) Intergenic
No off target data available for this crispr