ID: 1134407172

View in Genome Browser
Species Human (GRCh38)
Location 16:13970630-13970652
Sequence TGCCACACAGCCACTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 3, 1: 5, 2: 16, 3: 72, 4: 345}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407165_1134407172 3 Left 1134407165 16:13970604-13970626 CCCACTCCCAGTGCACAGATTCT No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345
1134407164_1134407172 22 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345
1134407168_1134407172 -4 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345
1134407167_1134407172 -3 Left 1134407167 16:13970610-13970632 CCCAGTGCACAGATTCTCTGTGC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345
1134407166_1134407172 2 Left 1134407166 16:13970605-13970627 CCACTCCCAGTGCACAGATTCTC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG 0: 3
1: 5
2: 16
3: 72
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407172 Original CRISPR TGCCACACAGCCACTGCTGG GGG Intergenic
900084090 1:878922-878944 TCCCAGACAGCCCCTGCTGTGGG + Intergenic
900405456 1:2490967-2490989 AGCCGCACAGGCTCTGCTGGGGG + Intronic
900501109 1:3005049-3005071 TGCCACGCAACCCCAGCTGGAGG - Intergenic
901022565 1:6262481-6262503 TGCCAGCCTCCCACTGCTGGTGG - Intergenic
901881930 1:12199172-12199194 TGCCCCACCCCCTCTGCTGGTGG - Intronic
902000075 1:13185077-13185099 TGCCAGTCTGCCCCTGCTGGTGG - Intergenic
902685075 1:18071179-18071201 GGTCACACAGCCATTGGTGGTGG - Intergenic
902873257 1:19326629-19326651 CCCCACCCAGCCCCTGCTGGAGG - Intronic
903514454 1:23901298-23901320 TTCCACACAGCCAGAGCTGGGGG - Intronic
904330556 1:29755549-29755571 TGCCCTGCAGCCCCTGCTGGGGG - Intergenic
904744358 1:32702223-32702245 TTCCACACAGCCACTTCAGCAGG + Intronic
905107848 1:35574602-35574624 TGCCACCCACGCACTGCTGGCGG - Intronic
905804997 1:40869938-40869960 GGCCACACAGCTAGTGATGGAGG + Intergenic
907958191 1:59251545-59251567 TGCCAGACTGCCCCTGCTCGGGG - Intergenic
908397701 1:63741262-63741284 TGCCCTGCAGCCACTGCTGGAGG + Intergenic
909213596 1:72855743-72855765 TGTCTCTCACCCACTGCTGGTGG - Intergenic
909848921 1:80434848-80434870 GTGCACAGAGCCACTGCTGGGGG + Intergenic
909902965 1:81160872-81160894 TGCCATGTGGCCACTGCTGGGGG - Intergenic
910333677 1:86104859-86104881 TGCCACTCGGCCGCTGCTGCTGG - Intronic
910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG + Intergenic
911664777 1:100539851-100539873 GGCCACGCAGCCACTGGTGTGGG + Exonic
913433756 1:118825801-118825823 TGGCACATAGCCAATGCTGTGGG - Intergenic
915287512 1:154862385-154862407 AGCCACACAGCCAGTGCTGGAGG + Intronic
916321706 1:163512167-163512189 TGCTACACAGCCACCACAGGTGG - Intergenic
917387390 1:174491931-174491953 TGCCATGCAGCCACTGCTGGGGG + Intronic
917656479 1:177131139-177131161 TGCCTCTCATCCACTTCTGGTGG + Intronic
917713328 1:177709528-177709550 TGCCACACTGCCACTGTGGGAGG - Intergenic
917738754 1:177943742-177943764 TGGCACACAGCAACTGCTTTCGG - Intronic
918826983 1:189336886-189336908 TGCCACACTGCTGCTGCTGCTGG + Intergenic
919067653 1:192713848-192713870 TGCTACATGGCCACTGCTGGGGG - Intergenic
919455761 1:197818221-197818243 TGCCATGCAGCCACTGCTGGAGG - Intergenic
920337965 1:205257625-205257647 TGCCACATAGCCACAGCTTCTGG - Intronic
920549452 1:206846334-206846356 CACCACACTGCCACTGATGGGGG - Intergenic
920755930 1:208732435-208732457 TGCCTCACAGATAATGCTGGTGG + Intergenic
921769642 1:219021433-219021455 TGCCATGCAGCCACTGCTAAGGG - Intergenic
922500497 1:226093887-226093909 AGCCACACAGCCAGTGCAAGGGG - Intergenic
923557067 1:235009704-235009726 TGCCAAGGAGGCACTGCTGGTGG + Intergenic
924244089 1:242064541-242064563 TCCCAGACAGCCCCTGCTGCGGG + Intergenic
924907323 1:248469899-248469921 TACCACACCACCGCTGCTGGGGG + Intergenic
924916787 1:248578214-248578236 TACCACACCTCCACTGCTGGGGG - Intergenic
1063979157 10:11439948-11439970 TGCCAGACAGATTCTGCTGGGGG + Intergenic
1067271869 10:44798699-44798721 TTCCACTCAGCCTTTGCTGGTGG - Intergenic
1067746478 10:48940192-48940214 TGCCACCCACCCAGTTCTGGAGG - Intronic
1067833991 10:49626707-49626729 GGCCATACAGACACTGCTAGGGG + Intronic
1069056150 10:63847066-63847088 TACCACACAGCTGCTGCTGAGGG - Intergenic
1070790561 10:79186912-79186934 AGCCACACTGCCCCTGCTGGAGG + Intronic
1072662625 10:97372029-97372051 CGCCACACAGCCACGCTTGGGGG - Intronic
1072751241 10:97980480-97980502 TTCCTCACAGCCACTACTGATGG - Intronic
1073678729 10:105679155-105679177 CACCACACCACCACTGCTGGGGG - Intergenic
1074533233 10:114311086-114311108 TGCCCCATAGCCTCTGCTTGGGG - Intronic
1074533423 10:114312097-114312119 GGCCCCATAGCCTCTGCTGGTGG - Intronic
1075015882 10:118909761-118909783 AGCCAGACACCCACTGCGGGAGG + Intergenic
1075289607 10:121217116-121217138 TGGCACACAGCCTTTGGTGGAGG - Intergenic
1076376698 10:129993096-129993118 AGCCACACAGCTGCTGCTAGGGG - Intergenic
1077136780 11:1003545-1003567 TGACAAACAGCCACTGGAGGAGG - Intronic
1077858756 11:6156758-6156780 TGTCACGTGGCCACTGCTGGGGG - Intergenic
1078503916 11:11914879-11914901 TATCACACATACACTGCTGGTGG + Intronic
1079760152 11:24319198-24319220 TGCCATGCAGCCACTCCTAGGGG + Intergenic
1080771602 11:35347154-35347176 TGCAAAACAGCCACTTCTGAGGG + Intronic
1081483245 11:43507929-43507951 TGCCCCAGAACCACTGCTGTAGG + Intergenic
1082085850 11:48048951-48048973 GCTCACACAGCCAATGCTGGAGG + Intronic
1083296199 11:61716972-61716994 GGCCACAGGGGCACTGCTGGGGG - Intronic
1083512898 11:63227981-63228003 TGCCACATGGCCAGTGCTGGGGG + Intronic
1084088134 11:66864154-66864176 TGCCACGCAGTCACTGCTACTGG + Intronic
1084467490 11:69334527-69334549 AGTCACACAGCCACTGAAGGTGG - Intronic
1085261244 11:75205899-75205921 GGCCAGGAAGCCACTGCTGGTGG - Exonic
1086563253 11:88193351-88193373 GGACACACATACACTGCTGGTGG - Intergenic
1086824258 11:91475710-91475732 TGCCACACTACCACTGATGCTGG + Intergenic
1088274057 11:108065648-108065670 TGCCATACAGCTGCTGCTGGGGG + Intronic
1089500474 11:118928974-118928996 TGCCACACAGAGCCTGCTGCCGG + Intronic
1089793951 11:120965571-120965593 TGACACACATCCAGTGCTGCAGG + Intronic
1090217581 11:124983761-124983783 TGCCACGCTGCCACTGCTGCTGG - Intronic
1090260321 11:125314653-125314675 TGCAGCACAGCCAGAGCTGGGGG - Intronic
1090374347 11:126278399-126278421 AACCACACAGCGACTTCTGGTGG - Intergenic
1090616950 11:128523027-128523049 TTCAACCCAACCACTGCTGGAGG - Intronic
1091326950 11:134698350-134698372 TGGAACCCAGCCACTGCTGATGG - Intergenic
1091344368 11:134843125-134843147 TGTCACTCAGCCTCTGCTGCTGG - Intergenic
1092477150 12:8828998-8829020 TGTACCACAGTCACTGCTGGGGG + Intronic
1093619879 12:21276688-21276710 TGCCATGTGGCCACTGCTGGGGG - Intronic
1093903451 12:24662077-24662099 CACCACACTGCCACTGCTGTGGG + Intergenic
1094813047 12:34160785-34160807 TCCCAGACAGCCTCTGCTGTGGG - Intergenic
1095624989 12:44304147-44304169 TGCCACGTGGCCACTGCTGGGGG - Intronic
1095812457 12:46384516-46384538 TTCCTCACAGCCTCTCCTGGGGG + Intergenic
1096513840 12:52145808-52145830 TGCCATAAAGCCACTGGTGCTGG + Intergenic
1096549688 12:52364032-52364054 TGCCACCCAGCCAGGGCAGGTGG - Intronic
1098347702 12:69523964-69523986 GTCCACACTGCCACTGCTGTTGG - Intronic
1098503835 12:71226514-71226536 CACTACACAGCCACTGCTGTGGG - Intronic
1099024389 12:77447558-77447580 CTCCATGCAGCCACTGCTGGAGG - Intergenic
1100061123 12:90576477-90576499 TGCCACAGGGCTGCTGCTGGGGG + Intergenic
1100904798 12:99285706-99285728 TGCCACACAGTCACTGCCAGGGG - Intronic
1101762452 12:107670035-107670057 TGACACACAGACACAGCTTGGGG + Intergenic
1102047223 12:109837017-109837039 TGACTCACAGCCAATGCTGAGGG - Intergenic
1102682967 12:114702960-114702982 TACCACAAAGGCCCTGCTGGGGG - Intergenic
1103461247 12:121106848-121106870 TGCCACATGGCCACTGCCAGGGG - Intergenic
1103484550 12:121273980-121274002 TTCCACAGAGGCCCTGCTGGGGG + Intronic
1103485294 12:121278905-121278927 GGCCACACAGCCAGGGCTGAGGG - Intronic
1104970670 12:132529298-132529320 TGTCCCACAGCTTCTGCTGGTGG + Intronic
1105450249 13:20493144-20493166 TGCTTGACAGCCACAGCTGGCGG - Intronic
1108997140 13:56748274-56748296 TGCCACACAGCCACTGCCAGGGG + Intergenic
1109100836 13:58181706-58181728 TGCCATGGAGCCACTGCTAGGGG + Intergenic
1109961769 13:69640072-69640094 TGCAACATGGCCACTGCTTGGGG + Intergenic
1111572194 13:90103623-90103645 TGCCATATGGCCACTGCTGGGGG + Intergenic
1112053927 13:95672068-95672090 TGCCACACAGTCACTGCCAGGGG + Intergenic
1112951820 13:105007289-105007311 TGCCAAACAGCTCCTGCTGCTGG + Intergenic
1113527274 13:110990806-110990828 TGCCACACTGCTTCAGCTGGTGG - Intergenic
1114266359 14:21074736-21074758 TCTCCCACAGCCTCTGCTGGGGG - Exonic
1114722296 14:24895497-24895519 TAGCACTCAGCCACTCCTGGTGG + Intronic
1115344514 14:32328041-32328063 TCCCACACCGCCTATGCTGGTGG + Intergenic
1115768438 14:36647134-36647156 TACCACACAGGCATTTCTGGAGG + Intergenic
1115925265 14:38425852-38425874 TCCCACACAGCTGCTGCTGGGGG + Intergenic
1115948529 14:38693837-38693859 CACCACACTGCCACTGCTGGGGG - Intergenic
1116021753 14:39469672-39469694 TGCCATGCAGCTGCTGCTGGAGG + Intergenic
1116269348 14:42741602-42741624 GACCACACTGCCACTGTTGGGGG - Intergenic
1117384379 14:55195859-55195881 TACCACATGGCCACTGGTGGAGG + Intergenic
1117504556 14:56389158-56389180 TGCCACATGGCCACTGCTGGAGG + Intergenic
1118071336 14:62249625-62249647 TGCCATACTGCTGCTGCTGGGGG - Intergenic
1121526360 14:94621979-94622001 TGCCATGCAGCCACTGCAGCTGG + Intronic
1122745528 14:103895121-103895143 AGCCACACAGCCAGAGCAGGGGG - Intergenic
1123112802 14:105880984-105881006 TGTCTCCCGGCCACTGCTGGAGG - Intergenic
1123122239 14:105922039-105922061 CTCCACACAGCCTCTGCTGGGGG - Intronic
1123404902 15:20013604-20013626 CTCCACACAGCCTCTGCTGGGGG - Intergenic
1123514233 15:21020252-21020274 CTCCACACAGCCTCTGCTGGGGG - Intergenic
1123722981 15:23076170-23076192 TGCCACAAAGCACCTGCTGCGGG + Intergenic
1123892427 15:24794746-24794768 AGGCACACAGGCACTGCAGGAGG + Intergenic
1125736025 15:41926436-41926458 AGCCACACAGAAAGTGCTGGGGG - Intronic
1126517733 15:49554641-49554663 CACTACACTGCCACTGCTGGGGG + Intronic
1126660841 15:51031520-51031542 TGCCACGTGGCCAGTGCTGGGGG + Intergenic
1127132517 15:55882318-55882340 TGCCATACAGCCACTGCCAGGGG - Intronic
1127143376 15:55999676-55999698 TGCCTCACTGCCACTGCTGTTGG - Intergenic
1129665383 15:77576639-77576661 AGTCACACAGCCCTTGCTGGTGG + Intergenic
1130938286 15:88488312-88488334 GCCCACACAGGCTCTGCTGGTGG - Intergenic
1131041663 15:89273734-89273756 TACCACACAGCCCCAGTTGGAGG + Intronic
1131510890 15:93048884-93048906 GGCCACACAGACACTGGGGGTGG + Intronic
1132456803 16:28646-28668 TTCCAGACAGTCAGTGCTGGGGG - Intergenic
1132797818 16:1733952-1733974 TACCACACAGCCACTGCTGCTGG - Intronic
1133525059 16:6597047-6597069 TGACAAACAGCCACTGTAGGGGG - Intronic
1133601193 16:7341913-7341935 TTCAACACACCCACTGCTGTGGG + Intronic
1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG + Intergenic
1134430951 16:14205913-14205935 TGCCAGACTGCCTCTGCTGCAGG + Intronic
1135304620 16:21357366-21357388 AGCCAAACAGCCACTGCTGTTGG + Intergenic
1136301363 16:29336493-29336515 AGCCAAATAGCCACTGCTGTTGG + Intergenic
1136389308 16:29952351-29952373 TGCCATGCAGCTACTGCTAGGGG + Intronic
1136577752 16:31134440-31134462 TGACACACAGCCAGTGCATGGGG + Intronic
1138012690 16:53397627-53397649 TGCCAGTCTGCCTCTGCTGGGGG - Intergenic
1138228868 16:55323752-55323774 TGCCCCGCGGCCACTGCGGGAGG + Exonic
1139005049 16:62559537-62559559 TGCCACATGGCTGCTGCTGGGGG + Intergenic
1140126794 16:72124677-72124699 TGCCAGACAGCCCTTGGTGGGGG - Intronic
1141028553 16:80569466-80569488 TGCCTCACAGCCAGGGATGGAGG + Intergenic
1141246626 16:82313899-82313921 TGGCACATAGGCATTGCTGGAGG - Intergenic
1142063060 16:88043190-88043212 AGCCAAACAGCCACTGCTGTTGG + Intronic
1142468539 17:149046-149068 AGCCACACCCCCACTGCTGTGGG + Intronic
1142492117 17:286033-286055 TGTCCCCCCGCCACTGCTGGGGG + Intronic
1144174557 17:12692616-12692638 TGCCACATGCCCGCTGCTGGTGG - Intronic
1144522943 17:15966488-15966510 GGCCACAGAGCCAGTGCAGGAGG + Intronic
1148547193 17:48527515-48527537 TTCCACCCAGCCACTCCTCGGGG - Intergenic
1148721139 17:49754179-49754201 TGCCACACAGCCCCTGTTTGGGG - Intronic
1150541382 17:66103774-66103796 TGCCATGTAGCCACTGCTGGGGG - Intronic
1151075591 17:71268677-71268699 TGCCACACAGACACTGATGTGGG + Intergenic
1152027503 17:77821372-77821394 TGCCACACGGTCCCTGCAGGTGG + Intergenic
1152762291 17:82115120-82115142 AGTCACACAGCCCCAGCTGGTGG - Intronic
1153075510 18:1157484-1157506 TACCAAGCTGCCACTGCTGGGGG - Intergenic
1153088504 18:1317600-1317622 TACCACACAGCTGCTGCTGGAGG - Intergenic
1153600318 18:6774773-6774795 CAACACACAGCCACTTCTGGTGG - Intronic
1155087033 18:22468702-22468724 TGCCACACAGCTGCTGCCAGGGG + Intergenic
1155398637 18:25414846-25414868 GGCCACACAGCAATTGTTGGTGG - Intergenic
1155767337 18:29652323-29652345 TGCCACACTGTTGCTGCTGGGGG - Intergenic
1156465860 18:37347571-37347593 GGCCGCACACCCTCTGCTGGAGG + Intronic
1156517450 18:37692749-37692771 TCCCACACAGCCTCTGCACGGGG + Intergenic
1156601045 18:38607348-38607370 TACCACACAGCCTTTGCTTGTGG - Intergenic
1157879188 18:51304059-51304081 TGCCACACAGCCACTGCCAGGGG - Intergenic
1157954431 18:52081372-52081394 CACCACACTGCCACTGCTGTGGG - Intergenic
1159224912 18:65521896-65521918 TGCCACCCAGCCACTGCTGAGGG - Intergenic
1159480529 18:68985586-68985608 TGCCACACAGCTCCTGCTACAGG - Intronic
1160910558 19:1471978-1472000 TGCCACCCAGCAGGTGCTGGAGG + Exonic
1161056867 19:2195107-2195129 TGCCACTCAGCCACTGAAAGGGG - Intronic
1161206840 19:3045979-3046001 TACCACTCAAGCACTGCTGGAGG + Intronic
1164469042 19:28513076-28513098 CACCACACAGGAACTGCTGGGGG + Intergenic
1164609409 19:29622068-29622090 TGGCACACAGCAACTGCAAGTGG + Intergenic
1164744532 19:30601429-30601451 TGGGACACAGCCCCTGATGGGGG + Intronic
1164986741 19:32653791-32653813 TGCCCCACACACACTGCTGCAGG + Intronic
1165151620 19:33763967-33763989 GGCCACCCAGCCAGGGCTGGGGG + Intronic
1166553056 19:43679585-43679607 TGCCAGAAAGCCACTGCTGCTGG + Intergenic
1166853445 19:45771029-45771051 TGGCCCACAGCCACGGCCGGGGG + Exonic
1167661072 19:50796473-50796495 TGCCACACAGCCATGGGTGTGGG - Intergenic
925054426 2:846250-846272 TGGCATAGAGCCACTGCTGGAGG - Intergenic
925802067 2:7611145-7611167 GGCCACACAGCCATGGGTGGGGG + Intergenic
926334095 2:11850281-11850303 GGGCACACAGCCGCAGCTGGAGG - Intergenic
927041735 2:19237290-19237312 TGCCACTCAGCCAGTGCCTGGGG - Intergenic
927693244 2:25223004-25223026 CTCCCCACACCCACTGCTGGGGG + Intergenic
928328133 2:30336193-30336215 TTCAACAGAGCCTCTGCTGGTGG - Intergenic
928715660 2:34056746-34056768 CACCATGCAGCCACTGCTGGGGG + Intergenic
929215009 2:39403423-39403445 CGCCACACTGCCACTGTGGGTGG - Intronic
929281848 2:40088253-40088275 TGCCACGGTTCCACTGCTGGGGG + Intergenic
929484130 2:42339694-42339716 ACCCACACAGCCACCCCTGGAGG + Intronic
929509649 2:42556669-42556691 AGCCAGAAAGCCACTCCTGGAGG + Intronic
930895554 2:56441458-56441480 TGACACACAGCCACTGCCAGGGG + Intergenic
931012298 2:57930416-57930438 GGCCACGCAGCCACTGCCAGGGG + Intronic
931582893 2:63796508-63796530 TGCCACACAGCCACTGCCAGGGG - Intronic
931759736 2:65406195-65406217 AGCCACAAAGACCCTGCTGGAGG + Intronic
932853521 2:75210694-75210716 TGCCACACTGCCACTGCCACTGG - Intergenic
935058528 2:99588656-99588678 TGCCACACAGCCTCTGCCACAGG + Intronic
936511414 2:113150464-113150486 TGCCACATGGCTGCTGCTGGGGG + Intergenic
937628234 2:124068236-124068258 TGCCACACAGCCACTGCCAGGGG - Intronic
937998967 2:127716907-127716929 TGCCACACAGGCACGACTGCTGG + Intronic
938952683 2:136269879-136269901 TGCCACTGATACACTGCTGGTGG + Intergenic
942077304 2:172367584-172367606 TGGCACACAGCAAGTGCTGTAGG - Intergenic
942862672 2:180635330-180635352 TGCCATGCGGCCACTGCTAGGGG - Intergenic
942972388 2:181971919-181971941 CACCACATGGCCACTGCTGGGGG + Intronic
943099666 2:183472273-183472295 TGCCACGCCACCATTGCTGGTGG + Intergenic
943302609 2:186222950-186222972 TGTCATGTAGCCACTGCTGGGGG - Intergenic
943653668 2:190483980-190484002 TGCCTCAAAGCCAATCCTGGGGG + Intronic
944263856 2:197703098-197703120 AGCAACACATACACTGCTGGTGG - Intronic
944279088 2:197873645-197873667 TGTCATACAGCCAAAGCTGGGGG + Intronic
944833180 2:203553478-203553500 TGCCACTCAGAAAATGCTGGAGG - Intergenic
944954928 2:204798193-204798215 TGCCAAGCAGCGGCTGCTGGGGG - Intronic
946103660 2:217351004-217351026 TGCCACACTGCTGCTGCTGCTGG - Intronic
946848219 2:223879908-223879930 TGCCAGACAGACACTGCAGAGGG + Intronic
947009283 2:225547662-225547684 TGCCATGTGGCCACTGCTGGGGG + Intronic
948228972 2:236335829-236335851 GCCCACACAGCCAATGCCGGGGG - Intronic
948807209 2:240458211-240458233 TGCCACACACCCATTCCAGGTGG + Intronic
1168747800 20:259067-259089 TCCCATACAGCCAGTGCAGGTGG + Exonic
1169573376 20:6930695-6930717 TGCCCCAAAGCCACTACTGAAGG + Intergenic
1170554156 20:17502383-17502405 TGCCACAAAGCCACTGGTCTGGG + Intronic
1170812002 20:19681382-19681404 TGACACACAGCCACTGTTCCTGG + Intronic
1171449464 20:25225618-25225640 AGACACACAGACACTGCTGACGG - Exonic
1173004308 20:39127763-39127785 TACCACACTGTCACTGCTGGCGG + Intergenic
1173709705 20:45143835-45143857 TGCCATGCAGCCTCTGCCGGGGG + Intergenic
1175222523 20:57425589-57425611 TACAACACAGACACTGCTGGCGG + Intergenic
1175338685 20:58213795-58213817 TGCCACACAGCTTGTGGTGGAGG + Intergenic
1175632280 20:60551257-60551279 CGCCACACAGCCACTGCTGGGGG + Intergenic
1176066985 20:63203036-63203058 TGCCCCACAGCCCCAGCAGGTGG - Exonic
1176987637 21:15456009-15456031 TGGCACAGAGCCCCTGCGGGAGG - Intergenic
1179707496 21:43190721-43190743 TGCCTCCAAGCCCCTGCTGGCGG + Intergenic
1179728867 21:43356168-43356190 TTCCACACAGCCCCTGCTGACGG - Intergenic
1180032632 21:45222861-45222883 GGACACACAGTCACTGCTGCGGG - Exonic
1180715897 22:17872068-17872090 TGCCACACAGGCCCTCCTAGAGG + Intronic
1180921122 22:19522239-19522261 GGCCACACAGCCCCTGGAGGAGG + Intergenic
1181062405 22:20287912-20287934 AGCCCCACAGACACTGATGGAGG - Intergenic
1181764966 22:25084881-25084903 TGAAACACGGCCACTCCTGGTGG + Intronic
1182000117 22:26913296-26913318 ACTCACACATCCACTGCTGGGGG - Intergenic
1182148953 22:28015141-28015163 TGGCAGACAGCCAGTGCTTGGGG - Intronic
1184507455 22:44913144-44913166 TCCCACACAGCCTCTGAAGGAGG - Intronic
1184807604 22:46805609-46805631 GGCCACATGGCCACTCCTGGTGG + Intronic
1184900912 22:47445874-47445896 TGCCCCACAGACACTGCCTGTGG - Intergenic
1185150350 22:49160600-49160622 TGCCACAGAGCCACGCCTGGCGG - Intergenic
950127266 3:10517577-10517599 TGCTACTCAGCCACTACTTGTGG + Intronic
950184534 3:10937032-10937054 TCCCACAAAGCTGCTGCTGGGGG + Intronic
950304590 3:11908161-11908183 TGCATCACCGCCACTGCTGCTGG - Intergenic
950469872 3:13177859-13177881 GGCTACACAGCCACTCTTGGAGG + Intergenic
953389330 3:42525503-42525525 TGTCACAAGGCCACGGCTGGGGG - Intronic
954709471 3:52498210-52498232 TCCCACAGAGCTGCTGCTGGGGG - Intronic
955356151 3:58234807-58234829 TGTCACACAGCAAATGCTTGGGG + Intergenic
956139028 3:66127132-66127154 TGGAATACAGACACTGCTGGAGG - Intergenic
957018981 3:75102162-75102184 TGCCACATAGCCACTGCCAGGGG + Intergenic
960869891 3:122238202-122238224 CACCACACGGCCACTGCTGGGGG - Intronic
961112703 3:124298570-124298592 TGCAACACAGCGGCTGCTGGTGG + Intronic
961653897 3:128431003-128431025 TGCCACTCAGCCCCTGCCAGTGG + Intergenic
962699149 3:137979795-137979817 CACCACACTGCCACTGCTGGGGG + Intergenic
963015856 3:140823281-140823303 TGCAGGACAGCCTCTGCTGGAGG - Intergenic
963020605 3:140869510-140869532 TGCTGCAAAGCCATTGCTGGGGG + Intergenic
963066329 3:141267157-141267179 TGCCACACAGCCAGGGGAGGTGG + Intronic
963557767 3:146815082-146815104 TGCAAGACAGCCATTGCTGAAGG - Intergenic
964021667 3:152021028-152021050 TGCCATGCAACCACTGCTGGGGG - Intergenic
964686659 3:159403437-159403459 TGCCATACAGCCACTGCCAAAGG - Intronic
964744127 3:159996598-159996620 TGCCACTCACCTACTGCTGTGGG - Intergenic
964803984 3:160587093-160587115 CACCATGCAGCCACTGCTGGGGG - Intergenic
965350064 3:167600354-167600376 TGCCACACAGACACTGTGGTGGG + Intronic
965783266 3:172310453-172310475 AGAAACACAGGCACTGCTGGAGG - Intronic
967013753 3:185463287-185463309 TTCCTCATAGCCAGTGCTGGAGG + Intronic
967677348 3:192316408-192316430 TGCCATGCAGCCACTAATGGGGG - Intronic
968340811 3:197954001-197954023 AGCAACACAGTCACTCCTGGCGG + Exonic
968655199 4:1775554-1775576 TGCCCCACAGGGAGTGCTGGCGG - Intergenic
969477488 4:7429804-7429826 GGCCACACAGCCAGTAGTGGAGG - Intronic
970207213 4:13666973-13666995 TGCCAGGCAGCCAGTGCTGAGGG + Intergenic
971095777 4:23400193-23400215 CACCACATGGCCACTGCTGGAGG + Intergenic
971701489 4:29983736-29983758 TGCCTCACAGCCACTGCCAGGGG - Intergenic
973227397 4:47801956-47801978 TGCCACACACCCACTGCTGGAGG - Intronic
973735771 4:53870309-53870331 TGCCATACAGCCATTGTCGGAGG - Intronic
973763123 4:54139226-54139248 TGCTACATGGCCGCTGCTGGGGG - Intronic
973763194 4:54139625-54139647 CACCACATGGCCACTGCTGGGGG - Intronic
974026002 4:56733639-56733661 TGCCACACCCCCTCTGATGGTGG - Intergenic
974240287 4:59237884-59237906 TACCATACTGCCACTGCTGCTGG - Intergenic
974609207 4:64193262-64193284 TACCACATAGCCACTGCTGGGGG + Intergenic
975629550 4:76386740-76386762 CTCTGCACAGCCACTGCTGGGGG - Intronic
975796875 4:78015397-78015419 TGCCAGCCAGCAGCTGCTGGAGG - Intergenic
976444000 4:85109698-85109720 TGCCACAAGGCCACTGTAGGGGG - Intergenic
979915731 4:126431268-126431290 TGCAACAAAGCCAGGGCTGGTGG + Intergenic
980956514 4:139434073-139434095 TGCCACGTGGCCACTGCTGGGGG + Intergenic
981140115 4:141258629-141258651 TGTCACACAGCCACAGCCAGTGG - Intergenic
981530921 4:145752991-145753013 TGCCACGTGGCCGCTGCTGGGGG + Intronic
981728728 4:147875160-147875182 AGCCACGCAGCCACTGCTGGAGG - Intronic
983492997 4:168411366-168411388 TGCCATGTGGCCACTGCTGGAGG - Intronic
983657844 4:170100980-170101002 TGCCACACAGCCACTGCTGAGGG - Intergenic
983735377 4:171052480-171052502 TAACACACATACACTGCTGGTGG - Intergenic
984727233 4:183033343-183033365 AGCCACATATCCAGTGCTGGGGG + Intergenic
985288135 4:188357990-188358012 ATACACACAGCCACAGCTGGCGG - Intergenic
985701528 5:1376093-1376115 TCCCACACAGTGGCTGCTGGTGG + Intergenic
985870370 5:2549544-2549566 TGGCACACTGGCACGGCTGGCGG - Intergenic
986756206 5:10839035-10839057 TGCCACAAGGTCACTGCTGGAGG - Intergenic
988384069 5:30539112-30539134 TGCCATACAGCTGCTGCTGGGGG - Intergenic
988502962 5:31798909-31798931 GGACACACGGCCACTGCTGGAGG + Exonic
990622217 5:57571818-57571840 TATCATGCAGCCACTGCTGGAGG - Intergenic
990851564 5:60210956-60210978 AGCGGCACAGCCACAGCTGGCGG + Intronic
992396781 5:76375818-76375840 GGCCACTCAGCTACTGGTGGAGG - Intergenic
992531919 5:77660166-77660188 TGTCATGCAGCCACTGCTGTGGG + Intergenic
993171144 5:84420232-84420254 TGCCACATGGCCACTGTTGGAGG + Intergenic
994319970 5:98383174-98383196 CACCACACACCCACTGCTGGTGG + Intergenic
994970564 5:106731284-106731306 TGCCATGCTGCCACTGCTGCTGG + Intergenic
996259192 5:121445363-121445385 TACCATACAGCCACTTCTAGAGG - Intergenic
996931748 5:128897007-128897029 TGCCATGCTGCCGCTGCTGGAGG + Intronic
997002922 5:129784034-129784056 TGCCATGTGGCCACTGCTGGAGG - Intergenic
997007502 5:129835629-129835651 TGCCACACAGCCACTTTTCAAGG - Intergenic
997087501 5:130818473-130818495 TGCCAGTCTGCCCCTGCTGGGGG - Intergenic
997188061 5:131901512-131901534 TGCTGCACTGCCACTGCTGCTGG + Intronic
997749554 5:136330998-136331020 TTTCCCCCAGCCACTGCTGGCGG - Intronic
998058024 5:139096084-139096106 TACCATACTGCCACTGTTGGGGG - Intronic
998675777 5:144406243-144406265 TGCCGCTCAGCCACTGCTTAGGG - Intronic
999849611 5:155523950-155523972 TGCCACTTGGCCACTGCTGGGGG + Intergenic
1002128901 5:177067371-177067393 TGCCACTCAGCCCCTGCTCCTGG + Intronic
1002590632 5:180289723-180289745 TCCCACACAGCCAGTCCTGGAGG + Intronic
1005037537 6:21570402-21570424 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1006067900 6:31475538-31475560 TCCCACAGCGCCACTGGTGGTGG + Intergenic
1006425091 6:33958771-33958793 TTGCACACAGACACTGTTGGAGG + Intergenic
1006538509 6:34720420-34720442 TTCCCCACAACCACTGTTGGTGG + Intergenic
1006797183 6:36739277-36739299 AGGCACAGAGCCACTGCCGGGGG - Intergenic
1007159584 6:39778218-39778240 TGGCACACAGTGACTGCTCGGGG + Intergenic
1008549156 6:52611088-52611110 TGCAACACAGAAACTTCTGGGGG - Intergenic
1008667298 6:53728771-53728793 TGCCACAGGGCCACCGCTAGAGG - Intergenic
1008727868 6:54442965-54442987 TACCACACTGCCCCTGCTGTGGG + Intergenic
1009298920 6:61990153-61990175 TGCCACAGTCCCTCTGCTGGGGG + Intronic
1009375383 6:62961762-62961784 TGCCACATGGCCACTGCCAGGGG + Intergenic
1014160825 6:118166214-118166236 GGCTACAAAGCCACTTCTGGTGG + Intronic
1014208408 6:118681981-118682003 TCCCACCCAGCCACAGCAGGTGG - Intronic
1014275617 6:119384925-119384947 TGCTACACAACTGCTGCTGGGGG + Intergenic
1015678929 6:135781859-135781881 CACCACACTGCCACTGCTGCTGG + Intergenic
1015812901 6:137179043-137179065 TGCCACACAGACATTGGAGGAGG + Intergenic
1016054851 6:139567570-139567592 TGCCATGCAGCCACTGCCAGGGG + Intergenic
1016061701 6:139637279-139637301 TGCCATGCAGTCACTGCTGTGGG + Intergenic
1017428576 6:154347531-154347553 TGCCACACAGCCAGTGGGGCTGG + Intronic
1017637842 6:156460393-156460415 TGCCACACAGCCACCTTTGCTGG + Intergenic
1018418963 6:163625525-163625547 AGGCACTCATCCACTGCTGGTGG - Intergenic
1018841474 6:167520437-167520459 AGCAACACAGACACTCCTGGAGG - Intergenic
1019780925 7:2939213-2939235 TACCAGGCAGCCACTCCTGGGGG + Intronic
1020042185 7:5012604-5012626 GCCCACCCAGCCACTGCAGGTGG - Intronic
1021034683 7:15784109-15784131 TACTACATGGCCACTGCTGGGGG - Intergenic
1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1022223709 7:28340977-28340999 TGCCACATGGCTACTGCTGGGGG + Intronic
1022226715 7:28371119-28371141 TGGCAGACAGCGACAGCTGGGGG + Intronic
1022517937 7:30987636-30987658 TGCCACAGGGTCCCTGCTGGAGG + Intronic
1022542105 7:31146879-31146901 CACCACACAGCCACTGATGGGGG + Intergenic
1023313659 7:38913303-38913325 TGCCACAGCGCAAGTGCTGGTGG - Intronic
1023547173 7:41330416-41330438 TGTCTCACCGCCACTGCTGCTGG - Intergenic
1023716128 7:43046253-43046275 TACCATGCAGCCACTGCTGGGGG - Intergenic
1024278270 7:47696976-47696998 TGCCACATTCCCACTGATGGAGG + Intronic
1024612815 7:51081666-51081688 TGCCACAGAGCCACTGGTGCTGG + Intronic
1024685380 7:51738782-51738804 GGTCACACAGCAACTCCTGGTGG - Intergenic
1024717128 7:52092415-52092437 TGTCTCCCAGCCTCTGCTGGAGG - Intergenic
1027604756 7:80287254-80287276 TGCCATGCAGCCACTGCCAGGGG - Intergenic
1028181374 7:87729376-87729398 TACCACTCAGCCATTGCTGGGGG - Intronic
1028347221 7:89798094-89798116 TGCCACACTGCCACTGCTGCTGG - Intergenic
1030391406 7:108932262-108932284 TGTCATGCAGCCACTGCTGAGGG + Intergenic
1030665511 7:112273406-112273428 GGCCACATGGCCACTGCTGGGGG + Intronic
1031259963 7:119506423-119506445 TACCACTCAGCCATTGCTGGGGG - Intergenic
1031294442 7:119983818-119983840 TGCCACACTGCCATTACTGATGG + Intergenic
1031657725 7:124379402-124379424 GGCCACACAGCCTCTGCTGGGGG - Intergenic
1032191390 7:129767804-129767826 TGCCACACAGCCAGGGGAGGGGG - Intergenic
1032919989 7:136534477-136534499 TGTCTGACAGCCACTGTTGGAGG - Intergenic
1033543885 7:142382115-142382137 TGCCTGCCAGGCACTGCTGGTGG - Intergenic
1035180911 7:157089128-157089150 TAGCACAGAGCCACAGCTGGTGG + Intergenic
1035346805 7:158205728-158205750 GGGCACACAGCCACTGCAGGGGG - Intronic
1039079088 8:33718243-33718265 TCCCACACAGCCAAGGCTTGGGG + Intergenic
1039393547 8:37202791-37202813 TGCCAAAGAGACACTGCAGGAGG - Intergenic
1039773841 8:40716340-40716362 TGCCACAAATCCACTACAGGAGG + Intronic
1042959296 8:74286107-74286129 TGCTTCACACCCATTGCTGGTGG + Intronic
1043738405 8:83775756-83775778 TGCCACAGTGCCACTGCTGCTGG + Intergenic
1043815698 8:84798525-84798547 GGCCACACAGCCAGAGGTGGTGG + Intronic
1044267900 8:90204805-90204827 TGCCACAAAGATACTCCTGGAGG + Intergenic
1044355510 8:91217903-91217925 TGCTTCACAGCCACTGTTGGAGG + Intronic
1045028962 8:98117193-98117215 TGCCCCACAGCTCCCGCTGGGGG + Exonic
1045041436 8:98228080-98228102 TGCCACTTGGCCACTGCTGGAGG + Intronic
1045493170 8:102685964-102685986 TGGCATACAGCCTCTGCTTGTGG + Intergenic
1045869935 8:106914267-106914289 TGCCACACAAACACTGCTAAAGG - Intergenic
1047005358 8:120614591-120614613 TGCCACATGGCCACGCCTGGAGG + Intronic
1049326360 8:142023461-142023483 TGCCACCCAGCCAGGGATGGGGG - Intergenic
1049690127 8:143954632-143954654 TGACACACAGCTACTCCTGCGGG - Intronic
1056406369 9:86279895-86279917 TTCCACACAGCCTGTGTTGGTGG - Intronic
1056516659 9:87358751-87358773 TGCCACATGGCTGCTGCTGGAGG - Intergenic
1057083957 9:92191905-92191927 TGACTCTCATCCACTGCTGGGGG - Intergenic
1057291111 9:93808043-93808065 TGCCCCACAGCCACAGAAGGTGG + Intergenic
1057303736 9:93900845-93900867 AGCCACACAGCCAGGGCTGGGGG - Intergenic
1057346693 9:94258100-94258122 CACCACAGAGCCACTGCTGGGGG - Intergenic
1059653985 9:116340505-116340527 TTCCACACAGCAACTCCTTGAGG - Intronic
1060122701 9:121009802-121009824 TGCTGCACAGTCACTGCTAGGGG - Intronic
1060181833 9:121539627-121539649 TGTCACCCAGCCATGGCTGGTGG - Intergenic
1061309920 9:129755442-129755464 GGCCACACAGCTACAGCTGAGGG - Intergenic
1061394903 9:130338429-130338451 TGCCACAGAGCCCCTCCTGCTGG + Intronic
1061673285 9:132201304-132201326 TGGCACCCAGCCTCTGCGGGCGG + Intronic
1062599320 9:137312867-137312889 GGGCACACAGACACTGCTGGAGG - Intronic
1062619699 9:137414779-137414801 TCCCACACCGCCACTCCAGGGGG + Intronic
1187612753 X:20960582-20960604 TGCCACACAGCTACTGCCAGGGG - Intergenic
1187836112 X:23434189-23434211 TACCACAATGCCACTGCTAGGGG - Intergenic
1188118663 X:26277824-26277846 TGTCACACTGTCACTGCTGGGGG + Intergenic
1188833922 X:34933240-34933262 TGCCACACTGCTGCTGCTGCTGG + Intergenic
1188917989 X:35935421-35935443 TGCCATGCTGCCACTGCTGGGGG + Intronic
1188974766 X:36659929-36659951 TGTCACACAGCTGCTGTTGGGGG - Intergenic
1188996037 X:36887340-36887362 TGCTACACATCCACTGCTGGTGG - Intergenic
1189690715 X:43613987-43614009 CACCAGACTGCCACTGCTGGAGG + Intergenic
1189869905 X:45370859-45370881 TGCCACACGGCTACTGCCAGGGG - Intergenic
1190537908 X:51447482-51447504 CACGACACTGCCACTGCTGGGGG + Intergenic
1190602765 X:52109182-52109204 TTCCATGTAGCCACTGCTGGGGG + Intergenic
1191033914 X:56005346-56005368 TGCTGCACAGCCACTGCTCCTGG - Intergenic
1191119129 X:56884828-56884850 TGCCTCATGGCCAGTGCTGGGGG - Intergenic
1191181236 X:57565743-57565765 TGTTCCACAGCCTCTGCTGGTGG + Intergenic
1191930188 X:66364280-66364302 TGCCACACAACCACTGCTGGGGG - Intergenic
1191943458 X:66504049-66504071 TTCCATGCAGCCACTGCTGAAGG - Intergenic
1192304568 X:69945023-69945045 TGCCACATGGCCACTGTTGGGGG + Intronic
1192679836 X:73241184-73241206 TGCCATATCACCACTGCTGGAGG - Intergenic
1192841070 X:74856809-74856831 TGCCACACAGCCACTGCTGGGGG - Intronic
1192855138 X:75000829-75000851 TGACACACAGCTGCTGCTGTGGG + Intergenic
1192872569 X:75198822-75198844 TGCCACAGAGCTGCTGCTGGGGG - Intergenic
1193004934 X:76605963-76605985 TGCCACATGGCCGCTGCTGAGGG - Intergenic
1193010455 X:76669690-76669712 TGCCACACTGCTACTGCTACTGG + Intergenic
1193136204 X:77973396-77973418 TGGAACACAAACACTGCTGGTGG - Intronic
1193293402 X:79805406-79805428 TGTCCCACAGCCACTGCAGCTGG + Intergenic
1193366839 X:80644405-80644427 TGCCATGCAGCCCCTGCTGGGGG + Intergenic
1193563476 X:83048390-83048412 TGCCATGTAGCCACTGCTGGGGG + Intergenic
1193593613 X:83419751-83419773 AGCTGCACTGCCACTGCTGGGGG + Intergenic
1194842089 X:98754871-98754893 CACCACACAGCTGCTGCTGGGGG + Intergenic
1194877664 X:99209049-99209071 CACCACACAGCCACTGTTGGGGG + Intergenic
1194922089 X:99779181-99779203 TACCACACCACCACTGCTAGGGG + Intergenic
1196096888 X:111809514-111809536 TGCCATGCAGCCACTGCCAGAGG + Intronic
1197015896 X:121626126-121626148 TGGTACACAGCTACTGCTAGCGG - Intergenic
1197382871 X:125766497-125766519 TGCCACATGGCCACTGCTAGGGG + Intergenic
1197670707 X:129273848-129273870 TGCCACATAGCCACTGCTGGAGG + Intergenic
1198271570 X:135060639-135060661 GGCCACTCATCCACTGCTGCGGG - Intergenic
1198773436 X:140155034-140155056 CACCACACAGCCACTTCTGAGGG - Intergenic
1199455313 X:148021247-148021269 TGCCATGCAGCCACTGCTGGGGG + Intronic
1200150268 X:153947979-153948001 TGCTGCACAGCTGCTGCTGGTGG + Exonic
1200399559 X:156011077-156011099 TTCCAGACAGTCAGTGCTGGGGG + Intergenic
1201355666 Y:13094566-13094588 TGCCTCACAAGCACTCCTGGTGG + Intergenic
1202032923 Y:20596952-20596974 TGCCACACAGCCACTGCTGGTGG - Intergenic