ID: 1134407172

View in Genome Browser
Species Human (GRCh38)
Location 16:13970630-13970652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407166_1134407172 2 Left 1134407166 16:13970605-13970627 CCACTCCCAGTGCACAGATTCTC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG No data
1134407167_1134407172 -3 Left 1134407167 16:13970610-13970632 CCCAGTGCACAGATTCTCTGTGC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG No data
1134407165_1134407172 3 Left 1134407165 16:13970604-13970626 CCCACTCCCAGTGCACAGATTCT No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG No data
1134407168_1134407172 -4 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG No data
1134407164_1134407172 22 Left 1134407164 16:13970585-13970607 CCTGCAATCACTGTGCTGTCCCA No data
Right 1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407172 Original CRISPR TGCCACACAGCCACTGCTGG GGG Intergenic