ID: 1134407173

View in Genome Browser
Species Human (GRCh38)
Location 16:13970632-13970654
Sequence TTCCCCCAGCAGTGGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 2, 1: 3, 2: 13, 3: 69, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407173_1134407179 -10 Left 1134407173 16:13970632-13970654 CCACACAGCCACTGCTGGGGGAA 0: 2
1: 3
2: 13
3: 69
4: 368
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data
1134407173_1134407180 -4 Left 1134407173 16:13970632-13970654 CCACACAGCCACTGCTGGGGGAA 0: 2
1: 3
2: 13
3: 69
4: 368
Right 1134407180 16:13970651-13970673 GGAAGGAGGAAGGGTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407173 Original CRISPR TTCCCCCAGCAGTGGCTGTG TGG (reversed) Intergenic
900081570 1:862500-862522 TTCCCTCTGCGGTGGCTGAGGGG + Intergenic
900084092 1:878924-878946 GTCCCACAGCAGGGGCTGTCTGG - Intergenic
900146823 1:1162210-1162232 TTCCCCCAGCTGTGGGTCTGTGG + Intergenic
900352105 1:2240073-2240095 TTCTCTCAGGAGTGTCTGTGGGG + Intronic
900405457 1:2490969-2490991 GGCCCCCAGCAGAGCCTGTGCGG - Intronic
900674860 1:3878903-3878925 TTCTTCCACGAGTGGCTGTGAGG + Intronic
900994409 1:6112734-6112756 TGTCCCCGGCATTGGCTGTGAGG + Intronic
901026090 1:6279430-6279452 TTGCCACAGAAGAGGCTGTGGGG + Intronic
902089834 1:13894183-13894205 TTACTCCAGCAGGGGCTGGGGGG - Intergenic
902369117 1:15994302-15994324 TGGCTCCAGCAGTGGCTGCGAGG - Intergenic
903514453 1:23901296-23901318 ATCCCCCAGCTCTGGCTGTGTGG + Intronic
904027481 1:27513756-27513778 CTCCCCCAGCAGTGCCTGGCAGG - Intergenic
904248048 1:29202109-29202131 TTCTCCCAGCTGTGGCAGAGAGG - Intronic
904406536 1:30293976-30293998 TTCCTCCAGCTTTGGCTGTTGGG - Intergenic
906409336 1:45566486-45566508 TTCCCCCAGCATTGACCTTGGGG + Intronic
907283937 1:53368529-53368551 TTAGCCCAGCAGAGGCTTTGTGG + Intergenic
907324829 1:53630460-53630482 TACTCCCACCAGTGACTGTGAGG + Intronic
907501711 1:54886270-54886292 CTCCGTCAGCAGAGGCTGTGAGG + Intronic
907655152 1:56334568-56334590 TACCCCCAGGACTTGCTGTGAGG + Intergenic
908397702 1:63741264-63741286 ATCCTCCAGCAGTGGCTGCAGGG - Intergenic
908769725 1:67585038-67585060 TTCCCCCAGGAGGGGCTGAGTGG + Intergenic
910470536 1:87547797-87547819 ATCCCCCAGCAGCAGTTGTGTGG - Intergenic
910610341 1:89134389-89134411 TTCTCAGAGCAGTGGCAGTGGGG - Intronic
912823469 1:112885534-112885556 TTCCTCCAGCACTGGCAGAGGGG + Intergenic
915287513 1:154862387-154862409 CTCCTCCAGCACTGGCTGTGTGG - Intronic
915442246 1:155952335-155952357 TGCCCCCTGCACTGGCAGTGGGG + Intronic
915591728 1:156874752-156874774 GGACCCCTGCAGTGGCTGTGCGG - Intronic
917387391 1:174491933-174491955 ATCCCCCAGCAGTGGCTGCATGG - Intronic
917656480 1:177131141-177131163 TTCCACCAGAAGTGGATGAGAGG - Intronic
918311406 1:183288027-183288049 TTCACCCAGCTGTGGCTGGTGGG + Intronic
918990056 1:191686005-191686027 ATACCCCAGCAGTGGCCATGTGG - Intergenic
919455760 1:197818219-197818241 ATCCTCCAGCAGTGGCTGCATGG + Intergenic
920549451 1:206846332-206846354 ATCCCCCATCAGTGGCAGTGTGG + Intergenic
921404493 1:214764591-214764613 TGGCACCAGCAGTGGCAGTGTGG + Intergenic
921478365 1:215636004-215636026 TGGCCCCAGCAGTGGCTGGATGG - Intronic
922500496 1:226093885-226093907 CTCCCCTTGCACTGGCTGTGTGG + Intergenic
922590189 1:226769784-226769806 TGCCCCCAGGGGTGGTTGTGGGG - Intergenic
922970462 1:229732143-229732165 TTCCCCCTCCAGCGGCTGTTGGG - Intergenic
923554193 1:234987752-234987774 TTCCACCTGCAGAGGCGGTGAGG - Intergenic
923674272 1:236065882-236065904 ATCCCCCAGCAGAGGATGTGGGG + Intergenic
924907324 1:248469901-248469923 ATCCCCCAGCAGCGGTGGTGTGG - Intergenic
924916786 1:248578212-248578234 ATCCCCCAGCAGTGGAGGTGTGG + Intergenic
1062876175 10:944562-944584 TTTCCCCAGCGCTGGCTGAGTGG - Intergenic
1063335602 10:5210444-5210466 GTGCCCCAGCAGGGACTGTGTGG + Intronic
1065129713 10:22608394-22608416 TTTCCTCAGCAGTAGCTGAGAGG - Intronic
1066495804 10:35940784-35940806 TTCTCCCAGCAGTTGGGGTGTGG + Intergenic
1066646506 10:37616171-37616193 TTCTCCCAGCAGTTGGGGTGTGG - Intergenic
1067159867 10:43816756-43816778 TTCCCACAGTTTTGGCTGTGAGG + Intergenic
1068071975 10:52207061-52207083 TTACCCCAGTAGTGGCAGTGTGG + Intronic
1068519718 10:58064888-58064910 TTTCCCTCTCAGTGGCTGTGGGG - Intergenic
1071086445 10:81873585-81873607 TTCCCCCAGCACTGTCTGATTGG - Intergenic
1072662624 10:97372027-97372049 TGCCCCCAAGCGTGGCTGTGTGG + Intronic
1073678728 10:105679153-105679175 ATCCCCCAGCAGTGGTGGTGTGG + Intergenic
1075424324 10:122329627-122329649 CTCCCCCGGCAGTGGCTGGGGGG - Intronic
1076354470 10:129841929-129841951 TTACCCCAGCACTGGCTGGGAGG + Intronic
1076376697 10:129993094-129993116 ATCCCCTAGCAGCAGCTGTGTGG + Intergenic
1076435308 10:130437118-130437140 TTCCACCAGCAGTGAATGAGAGG + Intergenic
1076732194 10:132444470-132444492 TTGTCCCATCAGTGTCTGTGTGG - Intronic
1076844354 10:133061707-133061729 TTCCCACAGCCGTGGCTGCTGGG + Intergenic
1076924711 10:133476502-133476524 TTTCACCTGCAGAGGCTGTGAGG - Intergenic
1077709544 11:4522507-4522529 TTCCTCTGGCAGTGGCAGTGTGG + Intergenic
1079330904 11:19532266-19532288 ATCACCCAGCACTAGCTGTGTGG + Intronic
1079414578 11:20221672-20221694 CTCCCCCAGCACAGGCTGTAAGG + Intergenic
1083512899 11:63227983-63228005 ATCCCCCAGCACTGGCCATGTGG - Intronic
1083528946 11:63398677-63398699 ATCTCCCAGCAGTGGCTGCCTGG - Intronic
1083864387 11:65445798-65445820 CTCCCACAGGAGTGGCTGAGGGG - Intergenic
1084450791 11:69235391-69235413 TTCTCCCAGGAGAGGCTGTTGGG + Intergenic
1084468360 11:69340569-69340591 TCTTCCCAGCATTGGCTGTGAGG + Intronic
1085347944 11:75780251-75780273 CTGCCCCAGCTGTGGCTGGGAGG - Intronic
1085419055 11:76339893-76339915 TTCCACATACAGTGGCTGTGTGG - Intergenic
1086381524 11:86259883-86259905 TCCCACCAGCAGTGTCTGAGAGG - Intronic
1088274058 11:108065650-108065672 ATCCCCCAGCAGCAGCTGTATGG - Intronic
1088985072 11:114898755-114898777 ATCCCCTAGCAGTGGCTGCATGG + Intergenic
1090374346 11:126278397-126278419 TGCCACCAGAAGTCGCTGTGTGG + Intergenic
1091597798 12:1890625-1890647 TTGGGGCAGCAGTGGCTGTGTGG - Intronic
1092766050 12:11853938-11853960 TTCCACCAACAGTGGAGGTGAGG + Intronic
1093259621 12:16918742-16918764 TTACTCCAGCAGTAGCTGTGTGG - Intergenic
1093903452 12:24662079-24662101 ATCCCACAGCAGTGGCAGTGTGG - Intergenic
1094655935 12:32419506-32419528 CATCCCCAGCAGTGGCTGCGTGG - Intronic
1094813045 12:34160783-34160805 GTCCCACAGCAGAGGCTGTCTGG + Intergenic
1095624988 12:44304145-44304167 ATCCCCCAGCAGTGGCCACGTGG + Intronic
1095717694 12:45365628-45365650 TTCCCCCTTCAGTGGCTGCTAGG + Intronic
1095812458 12:46384518-46384540 GACCCCCAGGAGAGGCTGTGAGG - Intergenic
1096306617 12:50483520-50483542 TTCCCCATGCTGTAGCTGTGGGG - Intergenic
1096549828 12:52364748-52364770 TTCCCCCAGAAGTAGCTCTAAGG + Intronic
1096585177 12:52615229-52615251 GTCCCCCAGCAGTGGGTGCTGGG - Intronic
1096816887 12:54207460-54207482 TAGCCCCAGCAGTGGAGGTGGGG + Intergenic
1097023153 12:56034914-56034936 ATCCCCCAGCAATGGCTGCCAGG + Exonic
1097734963 12:63172467-63172489 TCCCCCAAGCAGTGACTCTGAGG + Intergenic
1097861424 12:64522333-64522355 TCCCCCCAGCAGGAGCTGGGAGG - Intergenic
1098347701 12:69523962-69523984 TGCCAACAGCAGTGGCAGTGTGG + Intronic
1098660558 12:73087892-73087914 TTGCTCCAGCAGTGGCTGAAAGG - Intergenic
1099024388 12:77447556-77447578 ATCCTCCAGCAGTGGCTGCATGG + Intergenic
1100904797 12:99285704-99285726 ATCCCCTGGCAGTGACTGTGTGG + Intronic
1101593291 12:106140787-106140809 TTCCCAGAGGATTGGCTGTGTGG + Intergenic
1102054831 12:109888573-109888595 TTCCCCCAGCGGTGTCTGTTGGG + Intergenic
1102248181 12:111368386-111368408 GTCCCCCAGCAGCGGGCGTGGGG + Intronic
1102412527 12:112732513-112732535 TTCCCCAAGAAATGGCTTTGTGG + Intronic
1103484551 12:121273982-121274004 TGCCCCCAGCAGGGCCTCTGTGG - Intronic
1103485293 12:121278903-121278925 GTCCCTCAGCCCTGGCTGTGTGG + Intronic
1103934106 12:124466272-124466294 CTCCTCCAGCTGTTGCTGTGGGG + Exonic
1105033293 12:132900184-132900206 TTCACACAGCAGTGGAGGTGCGG - Intronic
1108256065 13:48612139-48612161 ATCCCACAGTAGTGGCTATGTGG - Intergenic
1108997141 13:56748276-56748298 TTCCCCTGGCAGTGGCTGTGTGG - Intergenic
1109747524 13:66646846-66646868 ATGCCCCAGCAGTGGCTTTGTGG + Intronic
1112053928 13:95672070-95672092 ATCCCCTGGCAGTGACTGTGTGG - Intergenic
1112530411 13:100196992-100197014 TTTCCCCAACATTGACTGTGGGG - Intronic
1113299702 13:109005112-109005134 TTCCCCCAGCATTCCCTCTGTGG - Intronic
1113424436 13:110196262-110196284 GGTCCCTAGCAGTGGCTGTGGGG - Intronic
1113531790 13:111032592-111032614 TTGCCCCACCTGTGGCTGAGTGG - Intergenic
1113594408 13:111521048-111521070 TTCCCCCAGGTGTGACTGTAAGG - Intergenic
1115925267 14:38425854-38425876 ATCCCCCAGCAGCAGCTGTGTGG - Intergenic
1115948528 14:38693835-38693857 ATCCCCCAGCAGTGGCAGTGTGG + Intergenic
1116269347 14:42741600-42741622 TGCCCCCAACAGTGGCAGTGTGG + Intergenic
1117504557 14:56389160-56389182 ATCCTCCAGCAGTGGCCATGTGG - Intergenic
1118713657 14:68543717-68543739 TGGCCCCAGCGGTGGCTGTATGG - Intronic
1119432801 14:74579268-74579290 TCTCCCCGGCAGTGGCTCTGGGG + Intronic
1119641520 14:76318711-76318733 CACCCACAGCAGTGGCTTTGAGG - Intronic
1119784923 14:77305945-77305967 CTCCAGCAGCTGTGGCTGTGAGG + Intronic
1120705785 14:87744141-87744163 CTGCCCCAGCTGTGGGTGTGAGG + Intergenic
1121375818 14:93410101-93410123 CTCACCTAGCAGTGGCTATGTGG + Intronic
1121463849 14:94101805-94101827 TTCCCGCAGTTGTGGCTGTGGGG + Exonic
1121474356 14:94182879-94182901 TTCTGCCAGCAGTGTCTGAGTGG + Intronic
1121514825 14:94542652-94542674 TTCCACCAACAGAGGATGTGAGG + Intergenic
1121534129 14:94679510-94679532 CACCCCAGGCAGTGGCTGTGGGG + Intergenic
1121710215 14:96032095-96032117 TTCCCCCAGAAGGGTCTTTGGGG - Intergenic
1123122238 14:105922037-105922059 GTCCCCCAGCAGAGGCTGTGTGG + Intronic
1123404901 15:20013602-20013624 GTCCCCCAGCAGAGGCTGTGTGG + Intergenic
1123514232 15:21020250-21020272 GTCCCCCAGCAGAGGCTGTGTGG + Intergenic
1125355356 15:38811878-38811900 TTCCCCAAGGAGTTGCTGTGGGG + Intergenic
1125736024 15:41926434-41926456 TGCCCCCAGCACTTTCTGTGTGG + Intronic
1126176290 15:45738814-45738836 TTCTCTCTGCAATGGCTGTGTGG + Intergenic
1126700923 15:51367014-51367036 TTACCCAAGGAGTGGCTATGAGG - Intronic
1127132516 15:55882316-55882338 ATCCCCTGGCAGTGGCTGTATGG + Intronic
1127143375 15:55999674-55999696 GTCCAACAGCAGTGGCAGTGAGG + Intergenic
1128780123 15:70353757-70353779 GTCCCCCAGCAGTGGAAGAGAGG - Intergenic
1129109598 15:73329775-73329797 TTCCCCCAGGAGTTGTTCTGTGG + Exonic
1129959759 15:79673599-79673621 CTCCCCCTGCTGTGGCTTTGCGG - Intergenic
1131041664 15:89273736-89273758 TTCCTCCAACTGGGGCTGTGTGG - Intronic
1132797817 16:1733950-1733972 CGCCAGCAGCAGTGGCTGTGTGG + Intronic
1132953233 16:2576812-2576834 TCCCCGCAGCAGAGGCTGGGAGG + Intronic
1132961119 16:2623356-2623378 TCCCCGCAGCAGAGGCTGGGAGG - Intergenic
1133221233 16:4319991-4320013 ATCCCCCAGCAGGGGCTGCTGGG - Intronic
1133284618 16:4684817-4684839 CTCCCTAAGCAGTGGCTCTGGGG - Intronic
1133301964 16:4787948-4787970 TTCCCCCAGCAGAGCCTGGAGGG + Intronic
1133336587 16:5010602-5010624 GGGACCCAGCAGTGGCTGTGAGG - Intronic
1134072894 16:11271818-11271840 CTCTCCCAGCAGCGGGTGTGCGG + Intronic
1134407173 16:13970632-13970654 TTCCCCCAGCAGTGGCTGTGTGG - Intergenic
1134891738 16:17847110-17847132 TTCTCCAAGCAGTGGCTGAGAGG + Intergenic
1135047989 16:19169534-19169556 CACCCCCAGCTGTGGCTGAGGGG - Intronic
1135172847 16:20201879-20201901 TTCCCCCAGAATTTTCTGTGTGG + Intergenic
1135304621 16:21357368-21357390 CTCCAACAGCAGTGGCTGTTTGG - Intergenic
1137541723 16:49367456-49367478 TTCCACCACCAGTGTCTCTGAGG + Intergenic
1137543020 16:49377686-49377708 TCCCCACAGCAGTGGCTGCAGGG + Intronic
1138147726 16:54627466-54627488 TTCCAGCAACAGTGACTGTGGGG + Intergenic
1139667022 16:68464387-68464409 TGCCCCCAGCAGTAACAGTGTGG - Intergenic
1139849505 16:69942006-69942028 GTCTCCAAGCAGTTGCTGTGGGG + Intergenic
1141042024 16:80681003-80681025 TTTCCCCAGCAGTGTTTGTGGGG - Intronic
1141561036 16:84867914-84867936 TTCCCGCAGCAGTGGCTGGGGGG - Intronic
1141870038 16:86779025-86779047 ATCTGCCAGCAGTGGCTGCGTGG - Intergenic
1142063061 16:88043192-88043214 CTCCAACAGCAGTGGCTGTTTGG - Intronic
1142275359 16:89115707-89115729 TTCCCCCTGCAATGGGTGGGAGG + Intronic
1142342890 16:89535701-89535723 CTCTCCCAGCAGAGGCGGTGGGG - Intronic
1142919129 17:3169295-3169317 ATCCCCCAGCAGTGGCTACATGG + Intergenic
1144134718 17:12282274-12282296 TTTCCCCTGCAGTGACTGAGTGG - Intergenic
1144650302 17:17002979-17003001 CTCAGCCAACAGTGGCTGTGGGG - Intergenic
1144815897 17:18034611-18034633 TTCCACCAGCAGTGTTTGAGGGG - Intronic
1148547192 17:48527513-48527535 GTCCCCGAGGAGTGGCTGGGTGG + Intergenic
1148721138 17:49754177-49754199 ATCCCCAAACAGGGGCTGTGTGG + Intronic
1148722969 17:49768112-49768134 TTCCCCAAGCAGTCCCTATGAGG + Intronic
1148739034 17:49881353-49881375 TTCTCCCAGCAGGGTCTGGGGGG + Intergenic
1149316909 17:55447282-55447304 TTCCCCTAATAGTGGCTATGAGG + Intergenic
1149467389 17:56890841-56890863 TTCCCATAGCCTTGGCTGTGGGG - Exonic
1149980687 17:61309002-61309024 CTCCCCCAGCAGAGGCTTTGAGG + Intronic
1150541381 17:66103772-66103794 ATCCCCCAGCAGTGGCTACATGG + Intronic
1151043865 17:70896243-70896265 TCCCCACAGCTGTGGCTATGGGG - Intergenic
1151075593 17:71268679-71268701 TCCCCACATCAGTGTCTGTGTGG - Intergenic
1151444472 17:74154093-74154115 ATCCCCAAGCAGAGGCTGAGCGG - Intergenic
1151493828 17:74447725-74447747 ACCCCCCTCCAGTGGCTGTGGGG + Intronic
1151825796 17:76523512-76523534 TTCCCCCAGCAAGGCCTCTGGGG + Intergenic
1152244018 17:79175951-79175973 TCTCCCCGGCACTGGCTGTGAGG - Intronic
1152371041 17:79888824-79888846 ATGCCCCAGCTGTGTCTGTGAGG + Intergenic
1153088503 18:1317598-1317620 ATCCTCCAGCAGCAGCTGTGTGG + Intergenic
1155719376 18:28991960-28991982 TGATACCAGCAGTGGCTGTGAGG + Intergenic
1156479987 18:37430242-37430264 TTCCACCAGCATTGACTGAGTGG - Intronic
1156877323 18:42030730-42030752 TCTCCCCAGAGGTGGCTGTGTGG + Intronic
1157104393 18:44759580-44759602 TTCCCCAAACAGTGTGTGTGGGG + Intronic
1157879186 18:51304057-51304079 TCCCCCTGGCAGTGGCTGTGTGG + Intergenic
1157954430 18:52081370-52081392 TACCCACAGCAGTGGCAGTGTGG + Intergenic
1158875672 18:61732543-61732565 TTCCCGCTGGAATGGCTGTGAGG - Intergenic
1159224911 18:65521894-65521916 ATCCCTCAGCAGTGGCTGGGTGG + Intergenic
1164469043 19:28513078-28513100 ATCCCCCAGCAGTTCCTGTGTGG - Intergenic
1165832139 19:38735581-38735603 TTGCCCCAGCTGGGGCTGTGTGG + Intronic
1166340124 19:42132417-42132439 TTCCCCCAGCCCTGGCGGGGCGG - Exonic
1166963940 19:46516443-46516465 CTCCCCGGGCAGTGGCAGTGGGG - Intronic
1167212324 19:48140917-48140939 TTCCCGCAGAGCTGGCTGTGCGG - Intronic
1168176838 19:54632798-54632820 CTCCCCCGGCAGGGCCTGTGCGG - Intronic
1168187626 19:54709889-54709911 CTCCCCCAGCAGGGCCTGTGCGG - Intergenic
926694758 2:15763473-15763495 TTCTCCCAGGAGGGGATGTGTGG + Intergenic
927693245 2:25223006-25223028 CACCCCCAGCAGTGGGTGTGGGG - Intergenic
928715661 2:34056748-34056770 ATCCCCCAGCAGTGGCTGCATGG - Intergenic
929484132 2:42339696-42339718 TTCCTCCAGGGGTGGCTGTGTGG - Intronic
929564760 2:42977411-42977433 TTTCCCCAGCAGTGACAGAGCGG - Intergenic
929661250 2:43786947-43786969 TTGCCCCAGCAGTGCCTTTAGGG + Intronic
930246864 2:48992462-48992484 CTTCCCTGGCAGTGGCTGTGTGG - Intronic
930460189 2:51664049-51664071 TTCACCCAGAGCTGGCTGTGTGG - Intergenic
930985531 2:57582988-57583010 TTCCCCCAACACTGTCTCTGAGG - Intergenic
931012299 2:57930418-57930440 ATCCCCTGGCAGTGGCTGCGTGG - Intronic
931582892 2:63796506-63796528 ATCCCCTGGCAGTGGCTGTGTGG + Intronic
931626525 2:64261146-64261168 TTGCCCCAGCATTGACCGTGTGG - Intergenic
934677271 2:96258451-96258473 TTCGCCCAGCAGAGGCTGGCTGG + Intronic
934758750 2:96841945-96841967 CTCCCCAGGCACTGGCTGTGTGG + Intronic
934761541 2:96859545-96859567 TTCCCACAGTGGTGGCTGCGGGG - Intergenic
935145884 2:100395082-100395104 CTGCCCCTGCAGTGGTTGTGTGG - Intronic
935578599 2:104736215-104736237 TTGCCTCAGCAGAGACTGTGTGG + Intergenic
936925224 2:117730280-117730302 ATGCCCCAGCAGTGGCTGAGGGG + Intergenic
937465749 2:122131677-122131699 AGCCCACAGCAGTGGCAGTGGGG + Intergenic
937628232 2:124068234-124068256 ACCCCCTGGCAGTGGCTGTGTGG + Intronic
937971558 2:127552882-127552904 TTCCCAAAGCAGAGGATGTGGGG + Intronic
938626633 2:133116764-133116786 TTCAGCCATTAGTGGCTGTGTGG + Intronic
940219649 2:151338371-151338393 TCTCCCCAACATTGGCTGTGAGG - Intergenic
940311158 2:152280083-152280105 TCACCCCAGCAGTGGCATTGGGG - Intergenic
940438308 2:153681741-153681763 TTTCCCCCGCAGTGGCCATGGGG + Intergenic
941749837 2:169122779-169122801 TTCTCTCAGCATTTGCTGTGTGG - Intergenic
942972389 2:181971921-181971943 ATCCCCCAGCAGTGGCCATGTGG - Intronic
943117620 2:183692495-183692517 CTCCCTCACCAGTGGCTATGTGG - Intergenic
943653669 2:190483982-190484004 ATCCCCCAGGATTGGCTTTGAGG - Intronic
944078468 2:195758688-195758710 ATCACCCGGCAGTGGCAGTGTGG + Intronic
946199971 2:218065687-218065709 TGCTCCCAGCAGTGGCCCTGGGG - Intronic
947263491 2:228251551-228251573 TGCCAGCAGCAGTGGCAGTGGGG + Intergenic
947312468 2:228819044-228819066 AAACCCCAGCAGTGGCAGTGTGG - Intergenic
947887394 2:233584550-233584572 TTAGCCCAGCAGTGTGTGTGAGG - Intergenic
948228970 2:236335827-236335849 AACCCCCGGCATTGGCTGTGTGG + Intronic
948266838 2:236641171-236641193 TTCCCACAGCTGCAGCTGTGAGG + Intergenic
948413284 2:237781478-237781500 TTTCCCTATCAGTGGCTCTGAGG + Intronic
949041860 2:241853267-241853289 TTCCCCCAGAAAGGGCTGTTTGG + Intronic
1170497920 20:16944807-16944829 CTCCCTCAGCAGCTGCTGTGGGG - Intergenic
1170673495 20:18457006-18457028 TCCCACCAGCAGTAGCTGAGGGG + Intronic
1170763494 20:19272124-19272146 TTCCACCCCCAGTGGCTGGGCGG - Intronic
1170813240 20:19691632-19691654 TGGCCCCAGCGGAGGCTGTGGGG + Intronic
1171036163 20:21714459-21714481 TTCCTCCCGCAGTGGCTGACAGG + Exonic
1171173904 20:23036974-23036996 TCTCCCAAGCAGTGGCTGTAAGG - Intergenic
1171461003 20:25297870-25297892 TTCCCCAGGCAGCGGCTCTGTGG + Exonic
1173251926 20:41368182-41368204 TGCCCCCTCCAGTGGCTCTGGGG + Intergenic
1173809669 20:45948232-45948254 CTCCCCCAGCAGGGCCTGTATGG + Intergenic
1174422874 20:50411713-50411735 CTCCTCCAGCAGGGGATGTGAGG + Intergenic
1174982261 20:55409070-55409092 ATCTCTCAGCAGTGGCTATGTGG - Intergenic
1175632281 20:60551259-60551281 ATCCCCCAGCAGTGGCTGTGTGG - Intergenic
1176082985 20:63283277-63283299 TTCCCCCAGTCGGGGCAGTGTGG + Intronic
1176366333 21:6035127-6035149 TACCTGCAGCAGGGGCTGTGAGG + Intergenic
1176994847 21:15543607-15543629 ATCCCCCAGCAATGGCCGCGTGG + Intergenic
1178795732 21:35742565-35742587 CTCCCCCAGGAGTGCCTATGTGG + Intronic
1178847659 21:36187096-36187118 TTCCCCCAGCAGACGGTGAGTGG + Intronic
1179294136 21:40045518-40045540 TTCCACCAGCAGAGACTGTCAGG + Intronic
1179757184 21:43503418-43503440 TACCTGCAGCAGGGGCTGTGAGG - Intergenic
1179799735 21:43805388-43805410 TACCCCCAGCAGGGCCTGTTGGG + Intergenic
1179883711 21:44304520-44304542 TTCGGCCAGCTGTGGCTGAGTGG + Intronic
1180839500 22:18952569-18952591 GTCCTCCATCAGTGTCTGTGGGG - Intergenic
1180921123 22:19522241-19522263 TTCCTCCTCCAGGGGCTGTGTGG - Intergenic
1180972207 22:19821605-19821627 TTCCCCCAGCAGTGGGGGAAGGG - Intronic
1181062404 22:20287910-20287932 GTCCTCCATCAGTGTCTGTGGGG + Intergenic
1183075916 22:35426644-35426666 TTCACCCAGGGGTGGCTGTGAGG + Intergenic
1183296259 22:37031231-37031253 TTCTCCCAGAAGTGGAAGTGAGG + Intergenic
1183509739 22:38227727-38227749 TCCCCGCAGCAGTGGCCCTGTGG - Intronic
1184909817 22:47522938-47522960 TTCCTCAAGAAGTGGCTTTGTGG - Intergenic
949997557 3:9630458-9630480 TTCACACAGAATTGGCTGTGTGG + Intergenic
950136481 3:10584628-10584650 TTCTGCAAGCAGTGGCTGGGAGG - Intronic
950184536 3:10937034-10937056 GTCCCCCAGCAGCAGCTTTGTGG - Intronic
950801208 3:15553024-15553046 ATGCCCCAGCAGTGGTTGTGTGG - Intergenic
952724708 3:36571697-36571719 TTCCACCAGCAAAGGCTGAGTGG - Intergenic
953612673 3:44460743-44460765 TTCACACAGAACTGGCTGTGCGG - Intronic
954709469 3:52498208-52498230 TTCCCCCAGCAGCAGCTCTGTGG + Intronic
954878462 3:53818514-53818536 TTTGCCCAGCAGTGGCTGCAGGG - Intronic
956191921 3:66616073-66616095 TTCCCCGTGGAGTGGTTGTGAGG - Intergenic
956293171 3:67683250-67683272 TTCCCCGAGCAGTTGCTATAAGG + Intergenic
956351410 3:68341132-68341154 TTCACACAGAGGTGGCTGTGTGG + Intronic
956451590 3:69380252-69380274 TTCCCACAGCAGCGTGTGTGGGG - Intronic
957018982 3:75102164-75102186 ATCCCCTGGCAGTGGCTATGTGG - Intergenic
959474232 3:106790128-106790150 ATCTCCCAGCAGTGGCTGCATGG + Intergenic
959505541 3:107152592-107152614 TTCCCTCAGCCAGGGCTGTGGGG - Intergenic
960869889 3:122238200-122238222 TCCCCCCAGCAGTGGCCGTGTGG + Intronic
961818665 3:129564191-129564213 TTCCCCCAGGAGGAGCCGTGGGG + Intronic
961954405 3:130786713-130786735 TTCCCCCATCAGTGGCAGAGGGG - Intergenic
962699150 3:137979797-137979819 ATCCCCCAGCAGTGGCAGTGTGG - Intergenic
963752988 3:149202231-149202253 TTCCCCCTGCAGTGACTCAGCGG - Exonic
964021666 3:152021026-152021048 ATCCCCCAGCAGTGGTTGCATGG + Intergenic
964488539 3:157210154-157210176 TTCTCCCCACAGTGCCTGTGTGG + Intergenic
964803983 3:160587091-160587113 GTCCCCCAGCAGTGGCTGCATGG + Intergenic
965350065 3:167600356-167600378 TTCCCACCACAGTGTCTGTGTGG - Intronic
965805621 3:172538494-172538516 TTCACGCAGAACTGGCTGTGCGG - Intergenic
966373274 3:179270668-179270690 TTCCCCCATCAGCTGCTGAGAGG + Intergenic
967013754 3:185463289-185463311 TTCCTCCAGCACTGGCTATGAGG - Intronic
967723500 3:192839963-192839985 TTTTACCTGCAGTGGCTGTGGGG - Intronic
968200445 3:196749713-196749735 TCCCACCAGCAATGGATGTGGGG + Intronic
968286283 3:197510754-197510776 CTCCCCTAGCAGTGGATTTGGGG - Exonic
968660608 4:1797334-1797356 GTACCCCAGCAGGGGCTGGGTGG - Intronic
969318879 4:6398630-6398652 TTCCCCCAGCAGTGTGTGAGGGG - Intronic
969371381 4:6733507-6733529 TTCCCCCAGCAGCGGCAGGCAGG - Intergenic
969888042 4:10234082-10234104 TGCCCCCAACAGTGGCTGGTAGG + Intergenic
971701488 4:29983734-29983756 CACCCCTGGCAGTGGCTGTGAGG + Intergenic
972750774 4:41986487-41986509 TGCCCCCACCTGTGGCTTTGGGG + Intergenic
972904380 4:43727528-43727550 TCCCCGCAGCAGTGGCCATGTGG + Intergenic
973227396 4:47801954-47801976 ATCCTCCAGCAGTGGGTGTGTGG + Intronic
973763192 4:54139623-54139645 ACCCCCCAGCAGTGGCCATGTGG + Intronic
974290608 4:59925411-59925433 TTCTCCCAGCAGTGGCTGTGTGG + Intergenic
974609208 4:64193264-64193286 CTCCCCCAGCAGTGGCTATGTGG - Intergenic
975469078 4:74743943-74743965 TGCTCCCATCAGTGTCTGTGTGG + Intergenic
975592910 4:76017907-76017929 TTCCCCTGGCAGTGGCCATGAGG - Intronic
977307322 4:95341801-95341823 AACTCCCAGCAGTAGCTGTGAGG + Intronic
980172540 4:129306669-129306691 TACCCCCCGCAGTGGCCTTGTGG - Intergenic
980442847 4:132870474-132870496 TTCTCCCAGCAGTGGTGGTGTGG + Intergenic
980752898 4:137115700-137115722 ATTCCCCAGCAGTGGTTTTGCGG + Intergenic
980988594 4:139718855-139718877 GTCCCCCAGAAGAGGCTGGGTGG - Exonic
981580257 4:146243316-146243338 GTCCCACAGCACTGGCGGTGGGG + Intergenic
981728726 4:147875158-147875180 GCCCTCCAGCAGTGGCTGCGTGG + Intronic
983657843 4:170100978-170101000 TTCCCTCAGCAGTGGCTGTGTGG + Intergenic
983972942 4:173896506-173896528 CAGACCCAGCAGTGGCTGTGAGG - Intergenic
984097834 4:175453507-175453529 TTCACGCAGAACTGGCTGTGTGG + Intergenic
984206382 4:176792499-176792521 TTTCCCCGGCACTGGCTGGGAGG - Exonic
984915474 4:184719297-184719319 ATCTCCCAGCAGTGGCTGCGTGG + Intronic
986245299 5:6001522-6001544 ATCCGGCAGCAGTGGCTTTGAGG + Intergenic
987127433 5:14827555-14827577 TGCCCGCAGCAGGGGCTTTGGGG - Intronic
988082612 5:26432989-26433011 ATCCCCCAGCAGTGGCCTTATGG + Intergenic
988384068 5:30539110-30539132 ATCCCCCAGCAGCAGCTGTATGG + Intergenic
988825460 5:34930150-34930172 TTCCCCCTACAGTGGCGATGCGG - Intronic
994028464 5:95113423-95113445 ATCCCCAAGCAGTGGCTGCATGG + Intronic
994319971 5:98383176-98383198 GTCCACCAGCAGTGGGTGTGTGG - Intergenic
995049570 5:107687492-107687514 ATCACCCAGCAGTGGCCATGTGG + Intergenic
995268751 5:110195781-110195803 TTCCCGTAGCTATGGCTGTGTGG - Intergenic
996582255 5:125044520-125044542 TGCAGCCAGGAGTGGCTGTGTGG + Intergenic
996956282 5:129187051-129187073 GTCCCCCGGCAGTGGCTGCATGG + Intergenic
997025222 5:130052309-130052331 TTCCCCCCACAGTGGGGGTGTGG + Intronic
998282812 5:140828724-140828746 TGCCCCCATCTGTGGCTGTCAGG - Exonic
998284114 5:140841954-140841976 TGCCCCCATCTGTGGCTGTCAGG - Exonic
998540503 5:142977086-142977108 TTCCCTCAGCTCTGTCTGTGTGG - Intronic
998685523 5:144519915-144519937 TTTCAGCAGCAGTGTCTGTGTGG + Intergenic
999111046 5:149121637-149121659 TTCCCACAGCAGTGGGAGTTAGG - Intergenic
999846001 5:155480963-155480985 TTCACCCAACACAGGCTGTGGGG + Intergenic
999849612 5:155523952-155523974 TTCCCCCAGCAGTGGCCAAGTGG - Intergenic
1001268867 5:170295901-170295923 TTCCCCCAGCTCAGGCAGTGAGG + Intronic
1001521332 5:172395714-172395736 TTCCCCCACCCCTGACTGTGTGG - Intronic
1001658647 5:173373826-173373848 TTCCCCCTGCAGTGGATGTTGGG - Intergenic
1002538966 5:179893685-179893707 CTCCCCCACCAGTGGCTGAAGGG + Intronic
1002590634 5:180289725-180289747 ATCCTCCAGGACTGGCTGTGTGG - Intronic
1002634573 5:180600752-180600774 TCACTCCAGGAGTGGCTGTGTGG - Intergenic
1003101513 6:3179862-3179884 TTCCTGCAGCAGCCGCTGTGAGG + Intergenic
1004069931 6:12288689-12288711 TTCCCCCAGCTGTGACTTCGAGG + Intergenic
1005972112 6:30769554-30769576 TCCCCTCAGCAGTCCCTGTGGGG - Intergenic
1006364500 6:33607460-33607482 CTTCCCCAGCAGTGGCTGGGAGG - Intergenic
1006511415 6:34523543-34523565 TTCTCTCACCAGTGGCTGTGAGG - Intronic
1006801930 6:36765222-36765244 TCCCCCCCGCAGTGGCTCTGGGG - Intronic
1007340982 6:41191516-41191538 TCTCCCCACCAGTGTCTGTGGGG + Exonic
1009298921 6:61990155-61990177 TTCCCCCAGCAGAGGGACTGTGG - Intronic
1009525979 6:64746995-64747017 TTCCCCAAGCTGTTGCTTTGAGG - Intronic
1009687932 6:66987336-66987358 GTCCCCCAGCAGTGGTGGTCTGG - Intergenic
1010528776 6:76941316-76941338 CTACCCCAGCAGTGGCCCTGTGG + Intergenic
1011139776 6:84140288-84140310 CTATCCCAGCAGTGCCTGTGTGG + Intronic
1011169943 6:84494255-84494277 TTCCCCTAGCAATGGCTATGTGG - Intergenic
1011810506 6:91127496-91127518 TTCCATCAGCTGTGGCTGAGAGG - Intergenic
1013726020 6:113096952-113096974 GTCCCCCAGTAGTGTCAGTGGGG + Intergenic
1014074042 6:117216210-117216232 ATCGCCCAGCAGCAGCTGTGTGG - Intergenic
1015273391 6:131359687-131359709 CTCCCCCAGGTGTGTCTGTGAGG - Intergenic
1015678930 6:135781861-135781883 TGCCAGCAGCAGTGGCAGTGTGG - Intergenic
1015941258 6:138454488-138454510 TTCCCCCAGTAATGACTGTATGG - Intronic
1016228585 6:141772750-141772772 ATTCCCCAGCAGCAGCTGTGTGG - Intergenic
1017727394 6:157284994-157285016 TTCACCCACCAGTGGCCCTGGGG + Intergenic
1018889858 6:167976140-167976162 CTCCCCCTGCAGTGTGTGTGTGG + Intergenic
1019721602 7:2575594-2575616 TCCCCACAGCACAGGCTGTGTGG - Intronic
1019780927 7:2939215-2939237 TCCCCCCAGGAGTGGCTGCCTGG - Intronic
1020042182 7:5012602-5012624 TCCCACCTGCAGTGGCTGGGTGG + Intronic
1021601567 7:22369456-22369478 TTCCCACATCAGTGTTTGTGAGG + Intergenic
1021822825 7:24515302-24515324 CTCCCCCAGCAGTTTCTGTATGG + Intergenic
1022033527 7:26513661-26513683 TTCCCCCAGTAGTGTCACTGGGG + Intergenic
1022197433 7:28082630-28082652 TTCACCCAGAAGAGGCTGCGAGG - Intronic
1022223710 7:28340979-28341001 ATCCCCCAGCAGTAGCCATGTGG - Intronic
1022542106 7:31146881-31146903 ATCCCCCATCAGTGGCTGTGTGG - Intergenic
1023716127 7:43046251-43046273 ATCCCCCAGCAGTGGCTGCATGG + Intergenic
1023751048 7:43372931-43372953 TTCCCATAGGAATGGCTGTGGGG - Intronic
1023815759 7:43948784-43948806 TTACCCCAGCACTGACTGAGTGG + Intronic
1024888569 7:54174792-54174814 TTCCCCCAATAGTGGCTGATTGG + Intergenic
1027604755 7:80287252-80287274 TTCCCCTGGCAGTGGCTGCATGG + Intergenic
1028181373 7:87729374-87729396 ATCCCCCAGCAATGGCTGAGTGG + Intronic
1028347220 7:89798092-89798114 TGCCAGCAGCAGTGGCAGTGTGG + Intergenic
1029096038 7:98085855-98085877 GCCCCCCAGCAGTGGGAGTGGGG + Intergenic
1029557285 7:101279199-101279221 TAGCACCAGCAATGGCTGTGGGG + Intergenic
1029978759 7:104858605-104858627 TTATCCCAGCAGGGGCTGTTGGG - Intronic
1030665512 7:112273408-112273430 ATCCCCCAGCAGTGGCCATGTGG - Intronic
1031259962 7:119506421-119506443 ATCCCCCAGCAATGGCTGAGTGG + Intergenic
1031412609 7:121457492-121457514 ATACCCCAGCAGTGGCTGCATGG - Intergenic
1031657724 7:124379400-124379422 CACCCCCAGCAGAGGCTGTGTGG + Intergenic
1033121209 7:138668319-138668341 TTCCCACAGAGCTGGCTGTGTGG - Intronic
1035126579 7:156612113-156612135 CTGCCCCAGGAGTGTCTGTGAGG - Intergenic
1035170813 7:157016633-157016655 TTCCCAGAGCTGTGGCAGTGGGG + Intergenic
1035523697 8:295050-295072 TTCCCTCTGCGGTGGCTGAGGGG - Intergenic
1035854908 8:2964358-2964380 TTTCCCCAGCCCTCGCTGTGGGG - Intronic
1036748439 8:11427213-11427235 GTACCTCAGGAGTGGCTGTGAGG - Intronic
1036817517 8:11913104-11913126 GACCCCCAACAGTGGCTGAGAGG - Intergenic
1037703742 8:21297868-21297890 TTCCCCCAGCTCTGGCTGTAGGG - Intergenic
1039079090 8:33718245-33718267 GTCCCCAAGCCTTGGCTGTGTGG - Intergenic
1040318558 8:46277547-46277569 TGCCCCCAGGGGTGGCAGTGGGG - Intergenic
1043554077 8:81409665-81409687 TTCCTCCAGCAGTGGCAGCATGG + Intergenic
1044635561 8:94320257-94320279 ATTCCCCAGCAGTGCCTCTGTGG - Intergenic
1046069984 8:109239248-109239270 TTCCCCCTCCAGAGGCTCTGAGG + Intergenic
1048571955 8:135663792-135663814 CTCCACAGGCAGTGGCTGTGAGG - Intergenic
1049535894 8:143181598-143181620 TTCCCGCAGCCGTGCCTGCGCGG + Intergenic
1049864174 8:144922991-144923013 TTCTCCCAGCAGCGGCCATGTGG - Intergenic
1050618737 9:7430234-7430256 ATGCCCCAGCAGTGCCTGCGTGG - Intergenic
1051306603 9:15717133-15717155 ATGCCCCAGCAGCGGCTATGTGG + Intronic
1051689843 9:19699361-19699383 TTCCAACAGCAGTGGATGAGAGG - Intronic
1057303735 9:93900843-93900865 CTCCCCCAGCCCTGGCTGTGTGG + Intergenic
1057346692 9:94258098-94258120 ATCCCCCAGCAGTGGCTCTGTGG + Intergenic
1057493361 9:95540173-95540195 TTTCCCCAGAAGTGGCCCTGAGG - Intergenic
1057845773 9:98521350-98521372 CTCACCCATCAGAGGCTGTGAGG - Intronic
1058935939 9:109769593-109769615 TTCACCCAACAGTGGTTGGGGGG + Intronic
1059343824 9:113615205-113615227 TTCCCTGGGCAGTGGCTGCGGGG - Intergenic
1059868667 9:118546106-118546128 TTGCACCAGCAGTGGTGGTGTGG - Intergenic
1060313088 9:122481397-122481419 TTCTCCCATCTGTGGCTTTGTGG - Intergenic
1061490767 9:130942910-130942932 CTGCCCCACCAATGGCTGTGTGG - Intergenic
1062573848 9:137197612-137197634 TTGCCCCAGAGGTGGCAGTGGGG - Intronic
1185498412 X:577336-577358 TTCCTTCAGCAATAGCTGTGAGG - Intergenic
1186121551 X:6368465-6368487 TTCCCCCAGTAGTGTGTGTGAGG + Intergenic
1187612752 X:20960580-20960602 ATCCCCTGGCAGTAGCTGTGTGG + Intergenic
1187836111 X:23434187-23434209 ATCCCCTAGCAGTGGCATTGTGG + Intergenic
1189659194 X:43278910-43278932 TTCCACAAGCAGCTGCTGTGCGG - Intergenic
1189690716 X:43613989-43614011 ATCCTCCAGCAGTGGCAGTCTGG - Intergenic
1190325997 X:49207099-49207121 TTTCCCCAGGAGAGGCTCTGGGG - Exonic
1190602766 X:52109184-52109206 ATCCCCCAGCAGTGGCTACATGG - Intergenic
1190808486 X:53861721-53861743 ATCCCCCAGCAGTGGCTGCAAGG - Intergenic
1190894029 X:54597900-54597922 TCCCCCCAGCAGTGGCAGCGGGG - Intergenic
1190908028 X:54747241-54747263 ATCCCCTAGCAGTGGCTGAGGGG - Intergenic
1191119128 X:56884826-56884848 CTCCCCCAGCACTGGCCATGAGG + Intergenic
1191930187 X:66364278-66364300 ATCCCCCAGCAGTGGTTGTGTGG + Intergenic
1192304569 X:69945025-69945047 ATCCCCCAACAGTGGCCATGTGG - Intronic
1192812348 X:74558509-74558531 TTCATGCAGCACTGGCTGTGCGG - Intergenic
1192841069 X:74856807-74856829 TTCCCCCAGCAGTGGCTGTGTGG + Intronic
1192872568 X:75198820-75198842 ATCCCCCAGCAGCAGCTCTGTGG + Intergenic
1193219774 X:78910507-78910529 ATCCCCTGGCAGTGGTTGTGCGG - Intergenic
1193366840 X:80644407-80644429 TACCCCCAGCAGGGGCTGCATGG - Intergenic
1193563477 X:83048392-83048414 CTCCCCCAGCAGTGGCTACATGG - Intergenic
1194253068 X:91602283-91602305 ATCCCCCAGCAGTGGCAGCCTGG + Intergenic
1194842090 X:98754873-98754895 ATCCCCCAGCAGCAGCTGTGTGG - Intergenic
1194877665 X:99209051-99209073 ATCCCCCAACAGTGGCTGTGTGG - Intergenic
1196508523 X:116477450-116477472 ATCTCCCAGCAGTGGATGTATGG - Intergenic
1197382872 X:125766499-125766521 ATCCCCTAGCAGTGGCCATGTGG - Intergenic
1197670708 X:129273850-129273872 ATCCTCCAGCAGTGGCTATGTGG - Intergenic
1197677498 X:129346410-129346432 TTCCCTAGGCAGTGGCAGTGTGG + Intergenic
1198271569 X:135060637-135060659 TACCCGCAGCAGTGGATGAGTGG + Intergenic
1198601921 X:138293457-138293479 TAGCCCTAGCAGTGGTTGTGAGG - Intergenic
1198773434 X:140155032-140155054 ACCCCTCAGAAGTGGCTGTGTGG + Intergenic
1199455314 X:148021249-148021271 ATCCCCCAGCAGTGGCTGCATGG - Intronic
1199656939 X:150005735-150005757 TTCCCCCGGCTGTGGCTCTAGGG + Intergenic
1199660472 X:150044813-150044835 ATCTCCCAGCAGTGGCAGTGTGG - Intergenic
1199962811 X:152791721-152791743 ATCTCCCAGTAGTTGCTGTGTGG + Intergenic
1201489405 Y:14524615-14524637 TTGCCCCAGCCGTGGCAGTGGGG - Intronic
1202032921 Y:20596950-20596972 ACCCACCAGCAGTGGCTGTGTGG + Intergenic