ID: 1134407179

View in Genome Browser
Species Human (GRCh38)
Location 16:13970645-13970667
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407167_1134407179 12 Left 1134407167 16:13970610-13970632 CCCAGTGCACAGATTCTCTGTGC No data
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data
1134407165_1134407179 18 Left 1134407165 16:13970604-13970626 CCCACTCCCAGTGCACAGATTCT No data
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data
1134407166_1134407179 17 Left 1134407166 16:13970605-13970627 CCACTCCCAGTGCACAGATTCTC No data
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data
1134407173_1134407179 -10 Left 1134407173 16:13970632-13970654 CCACACAGCCACTGCTGGGGGAA 0: 2
1: 3
2: 13
3: 69
4: 368
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data
1134407168_1134407179 11 Left 1134407168 16:13970611-13970633 CCAGTGCACAGATTCTCTGTGCC No data
Right 1134407179 16:13970645-13970667 GCTGGGGGAAGGAGGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407179 Original CRISPR GCTGGGGGAAGGAGGAAGGG TGG Intergenic
No off target data available for this crispr