ID: 1134407207

View in Genome Browser
Species Human (GRCh38)
Location 16:13970978-13971000
Sequence AACCCAGTAATTTCCTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407207_1134407212 12 Left 1134407207 16:13970978-13971000 CCTAGAAAGGAAATTACTGGGTT No data
Right 1134407212 16:13971013-13971035 TATGTTCAACTTCAGGGTAGAGG No data
1134407207_1134407210 5 Left 1134407207 16:13970978-13971000 CCTAGAAAGGAAATTACTGGGTT No data
Right 1134407210 16:13971006-13971028 GTTTATGTATGTTCAACTTCAGG No data
1134407207_1134407211 6 Left 1134407207 16:13970978-13971000 CCTAGAAAGGAAATTACTGGGTT No data
Right 1134407211 16:13971007-13971029 TTTATGTATGTTCAACTTCAGGG No data
1134407207_1134407213 13 Left 1134407207 16:13970978-13971000 CCTAGAAAGGAAATTACTGGGTT No data
Right 1134407213 16:13971014-13971036 ATGTTCAACTTCAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407207 Original CRISPR AACCCAGTAATTTCCTTTCT AGG (reversed) Intergenic
No off target data available for this crispr