ID: 1134407210

View in Genome Browser
Species Human (GRCh38)
Location 16:13971006-13971028
Sequence GTTTATGTATGTTCAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134407207_1134407210 5 Left 1134407207 16:13970978-13971000 CCTAGAAAGGAAATTACTGGGTT No data
Right 1134407210 16:13971006-13971028 GTTTATGTATGTTCAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134407210 Original CRISPR GTTTATGTATGTTCAACTTC AGG Intergenic
No off target data available for this crispr