ID: 1134409887

View in Genome Browser
Species Human (GRCh38)
Location 16:13995118-13995140
Sequence AAGATCAACCAACGAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134409887_1134409895 26 Left 1134409887 16:13995118-13995140 CCAGCCCTTCGTTGGTTGATCTT No data
Right 1134409895 16:13995167-13995189 TCAGATGTCCCCCAGTAAGGAGG No data
1134409887_1134409891 0 Left 1134409887 16:13995118-13995140 CCAGCCCTTCGTTGGTTGATCTT No data
Right 1134409891 16:13995141-13995163 CGGATAAAAAGAGACCTCGTTGG No data
1134409887_1134409892 1 Left 1134409887 16:13995118-13995140 CCAGCCCTTCGTTGGTTGATCTT No data
Right 1134409892 16:13995142-13995164 GGATAAAAAGAGACCTCGTTGGG No data
1134409887_1134409894 23 Left 1134409887 16:13995118-13995140 CCAGCCCTTCGTTGGTTGATCTT No data
Right 1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134409887 Original CRISPR AAGATCAACCAACGAAGGGC TGG (reversed) Intergenic
No off target data available for this crispr