ID: 1134409890

View in Genome Browser
Species Human (GRCh38)
Location 16:13995123-13995145
Sequence ATCCGAAGATCAACCAACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134409890_1134409895 21 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409895 16:13995167-13995189 TCAGATGTCCCCCAGTAAGGAGG No data
1134409890_1134409891 -5 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409891 16:13995141-13995163 CGGATAAAAAGAGACCTCGTTGG No data
1134409890_1134409894 18 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG No data
1134409890_1134409892 -4 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409892 16:13995142-13995164 GGATAAAAAGAGACCTCGTTGGG No data
1134409890_1134409896 27 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409896 16:13995173-13995195 GTCCCCCAGTAAGGAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134409890 Original CRISPR ATCCGAAGATCAACCAACGA AGG (reversed) Intergenic
No off target data available for this crispr