ID: 1134409891

View in Genome Browser
Species Human (GRCh38)
Location 16:13995141-13995163
Sequence CGGATAAAAAGAGACCTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134409890_1134409891 -5 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409891 16:13995141-13995163 CGGATAAAAAGAGACCTCGTTGG No data
1134409889_1134409891 -4 Left 1134409889 16:13995122-13995144 CCCTTCGTTGGTTGATCTTCGGA No data
Right 1134409891 16:13995141-13995163 CGGATAAAAAGAGACCTCGTTGG No data
1134409887_1134409891 0 Left 1134409887 16:13995118-13995140 CCAGCCCTTCGTTGGTTGATCTT No data
Right 1134409891 16:13995141-13995163 CGGATAAAAAGAGACCTCGTTGG No data
1134409885_1134409891 30 Left 1134409885 16:13995088-13995110 CCACAAATGATTGACAAAGACTG No data
Right 1134409891 16:13995141-13995163 CGGATAAAAAGAGACCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134409891 Original CRISPR CGGATAAAAAGAGACCTCGT TGG Intergenic
No off target data available for this crispr