ID: 1134409892

View in Genome Browser
Species Human (GRCh38)
Location 16:13995142-13995164
Sequence GGATAAAAAGAGACCTCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134409890_1134409892 -4 Left 1134409890 16:13995123-13995145 CCTTCGTTGGTTGATCTTCGGAT No data
Right 1134409892 16:13995142-13995164 GGATAAAAAGAGACCTCGTTGGG No data
1134409887_1134409892 1 Left 1134409887 16:13995118-13995140 CCAGCCCTTCGTTGGTTGATCTT No data
Right 1134409892 16:13995142-13995164 GGATAAAAAGAGACCTCGTTGGG No data
1134409889_1134409892 -3 Left 1134409889 16:13995122-13995144 CCCTTCGTTGGTTGATCTTCGGA No data
Right 1134409892 16:13995142-13995164 GGATAAAAAGAGACCTCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134409892 Original CRISPR GGATAAAAAGAGACCTCGTT GGG Intergenic
No off target data available for this crispr