ID: 1134411302

View in Genome Browser
Species Human (GRCh38)
Location 16:14004736-14004758
Sequence ATTTGGAAGAGGAAGCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134411296_1134411302 29 Left 1134411296 16:14004684-14004706 CCCAGAGGGAGTGAAGGAATGGC No data
Right 1134411302 16:14004736-14004758 ATTTGGAAGAGGAAGCTTCAGGG No data
1134411297_1134411302 28 Left 1134411297 16:14004685-14004707 CCAGAGGGAGTGAAGGAATGGCC No data
Right 1134411302 16:14004736-14004758 ATTTGGAAGAGGAAGCTTCAGGG No data
1134411298_1134411302 7 Left 1134411298 16:14004706-14004728 CCGAGTGCTGAGCTCTGTGCTGC No data
Right 1134411302 16:14004736-14004758 ATTTGGAAGAGGAAGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134411302 Original CRISPR ATTTGGAAGAGGAAGCTTCA GGG Intergenic
No off target data available for this crispr