ID: 1134414295

View in Genome Browser
Species Human (GRCh38)
Location 16:14030326-14030348
Sequence CAGTGTGGTTAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134414295_1134414304 11 Left 1134414295 16:14030326-14030348 CCCTCTGCCCTCTAACCACACTG No data
Right 1134414304 16:14030360-14030382 GATATAGCTGGTTCAGGCCCTGG No data
1134414295_1134414303 5 Left 1134414295 16:14030326-14030348 CCCTCTGCCCTCTAACCACACTG No data
Right 1134414303 16:14030354-14030376 GAGTCAGATATAGCTGGTTCAGG No data
1134414295_1134414301 -1 Left 1134414295 16:14030326-14030348 CCCTCTGCCCTCTAACCACACTG No data
Right 1134414301 16:14030348-14030370 GCCACGGAGTCAGATATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134414295 Original CRISPR CAGTGTGGTTAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr