ID: 1134414614

View in Genome Browser
Species Human (GRCh38)
Location 16:14032726-14032748
Sequence AACCCCAGGTAGCTACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134414612_1134414614 -6 Left 1134414612 16:14032709-14032731 CCTGTGGGGTCTATATGAACCCC No data
Right 1134414614 16:14032726-14032748 AACCCCAGGTAGCTACTGCCAGG No data
1134414610_1134414614 1 Left 1134414610 16:14032702-14032724 CCCTTAACCTGTGGGGTCTATAT No data
Right 1134414614 16:14032726-14032748 AACCCCAGGTAGCTACTGCCAGG No data
1134414611_1134414614 0 Left 1134414611 16:14032703-14032725 CCTTAACCTGTGGGGTCTATATG No data
Right 1134414614 16:14032726-14032748 AACCCCAGGTAGCTACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134414614 Original CRISPR AACCCCAGGTAGCTACTGCC AGG Intergenic
No off target data available for this crispr