ID: 1134418103

View in Genome Browser
Species Human (GRCh38)
Location 16:14062007-14062029
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134418095_1134418103 18 Left 1134418095 16:14061966-14061988 CCAACTGGAGTTGGTCTGACCAC No data
Right 1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG No data
1134418098_1134418103 -1 Left 1134418098 16:14061985-14062007 CCACATGCATTAGCTCAGGGAAG No data
Right 1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134418103 Original CRISPR GAGAGTGGCCAGGGCTTTGT GGG Intergenic
No off target data available for this crispr