ID: 1134419070 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:14069931-14069953 |
Sequence | ACTCACCAGATGGAGGAAGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134419070_1134419075 | 1 | Left | 1134419070 | 16:14069931-14069953 | CCCACTTCCTCCATCTGGTGAGT | No data | ||
Right | 1134419075 | 16:14069955-14069977 | GAGTGAGGTTGAAACATGCAAGG | No data | ||||
1134419070_1134419077 | 18 | Left | 1134419070 | 16:14069931-14069953 | CCCACTTCCTCCATCTGGTGAGT | No data | ||
Right | 1134419077 | 16:14069972-14069994 | GCAAGGGCACCCACATGCTCTGG | No data | ||||
1134419070_1134419076 | 2 | Left | 1134419070 | 16:14069931-14069953 | CCCACTTCCTCCATCTGGTGAGT | No data | ||
Right | 1134419076 | 16:14069956-14069978 | AGTGAGGTTGAAACATGCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134419070 | Original CRISPR | ACTCACCAGATGGAGGAAGT GGG (reversed) | Intergenic | ||