ID: 1134419070

View in Genome Browser
Species Human (GRCh38)
Location 16:14069931-14069953
Sequence ACTCACCAGATGGAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419070_1134419075 1 Left 1134419070 16:14069931-14069953 CCCACTTCCTCCATCTGGTGAGT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419070_1134419076 2 Left 1134419070 16:14069931-14069953 CCCACTTCCTCCATCTGGTGAGT No data
Right 1134419076 16:14069956-14069978 AGTGAGGTTGAAACATGCAAGGG No data
1134419070_1134419077 18 Left 1134419070 16:14069931-14069953 CCCACTTCCTCCATCTGGTGAGT No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419070 Original CRISPR ACTCACCAGATGGAGGAAGT GGG (reversed) Intergenic