ID: 1134419071

View in Genome Browser
Species Human (GRCh38)
Location 16:14069932-14069954
Sequence AACTCACCAGATGGAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419071_1134419077 17 Left 1134419071 16:14069932-14069954 CCACTTCCTCCATCTGGTGAGTT No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data
1134419071_1134419076 1 Left 1134419071 16:14069932-14069954 CCACTTCCTCCATCTGGTGAGTT No data
Right 1134419076 16:14069956-14069978 AGTGAGGTTGAAACATGCAAGGG No data
1134419071_1134419075 0 Left 1134419071 16:14069932-14069954 CCACTTCCTCCATCTGGTGAGTT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419071 Original CRISPR AACTCACCAGATGGAGGAAG TGG (reversed) Intergenic