ID: 1134419072

View in Genome Browser
Species Human (GRCh38)
Location 16:14069938-14069960
Sequence TCACTCAACTCACCAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419072_1134419076 -5 Left 1134419072 16:14069938-14069960 CCTCCATCTGGTGAGTTGAGTGA No data
Right 1134419076 16:14069956-14069978 AGTGAGGTTGAAACATGCAAGGG No data
1134419072_1134419075 -6 Left 1134419072 16:14069938-14069960 CCTCCATCTGGTGAGTTGAGTGA No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419072_1134419077 11 Left 1134419072 16:14069938-14069960 CCTCCATCTGGTGAGTTGAGTGA No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data
1134419072_1134419080 29 Left 1134419072 16:14069938-14069960 CCTCCATCTGGTGAGTTGAGTGA No data
Right 1134419080 16:14069990-14070012 TCTGGCCTGTACACAGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419072 Original CRISPR TCACTCAACTCACCAGATGG AGG (reversed) Intergenic